One-dimensional Silicon And Germanium Nanostructures With No Carbon Analogues.

In this work we report new silicon and germanium tubular nanostructures with no corresponding stable carbon analogues. The electronic and mechanical properties of these new tubes were investigated through ab initio methods. Our results show that these structures have lower energy than their corresponding nanoribbon structures and are stable up to high temperatures (500 and 1000 K, for silicon and germanium tubes, respectively). Both tubes are semiconducting with small indirect band gaps, which can be significantly altered by both compressive and tensile strains. Large bandgap variations of almost 50% were observed for strain rates as small as 3%, suggesting their possible applications in sensor devices. They also present high Young's modulus values (0.25 and 0.15 TPa, respectively). TEM images were simulated to help in the identification of these new structures.

Bioremediation Potential Of Microorganisms Derived From Petroleum Reservoirs.

Bacterial strains and metagenomic clones, both obtained from petroleum reservoirs, were evaluated for petroleum degradation abilities either individually or in pools using seawater microcosms for 21 days. Gas Chromatography-Flame Ionization Detector (GC-FID) and Gas Chromatography-Mass Spectrometry (GC-MS) analyses were carried out to evaluate crude oil degradation. The results showed that metagenomic clones 1A and 2B were able to biodegrade n-alkanes (C14 to C33) and isoprenoids (phytane and pristane), with rates ranging from 31% to 47%, respectively. The bacteria Dietzia maris CBMAI 705 and Micrococcus sp. CBMAI 636 showed higher rates reaching 99% after 21 days. The metagenomic clone pool biodegraded these compounds at rates ranging from 11% to 45%. Regarding aromatic compound biodegradation, metagenomic clones 2B and 10A were able to biodegrade up to 94% of phenanthrene and methylphenanthrenes (3-MP, 2-MP, 9-MP and 1-MP) with rates ranging from 55% to 70% after 21 days, while the bacteria Dietzia maris CBMAI 705 and Micrococcus sp. CBMAI 636 were able to biodegrade 63% and up to 99% of phenanthrene, respectively, and methylphenanthrenes (3-MP, 2-MP, 9-MP and 1-MP) with rates ranging from 23% to 99% after 21 days. In this work, isolated strains as well as metagenomic clones were capable of degrading several petroleum compounds, revealing an innovative strategy and a great potential for further biotechnological and bioremediation applications.

Genomic And Chemical Insights Into Biosurfactant Production By The Mangrove-derived Strain Bacillus Safensis Ccma-560.

Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.

Ethanol Modulates The Synthesis And Catabolism Of Retinoic Acid In The Rat Prostate.

All-trans retinoic acid (atRA) maintains physiological stability of the prostate, and we reported that ethanol intake increases atRA in the rat prostate; however the mechanisms underlying these changes are unknown. We evaluated the impact of a low- and high-dose ethanol intake (UChA and UChB strains) on atRA metabolism in the dorsal and lateral prostate. Aldehyde dehydrogenase (ALDH) subtype 1A3 was increased in the dorsal prostate of UChA animals while ALDH1A1 and ALDH1A2 decreased in the lateral prostate. In UChB animals, ALDH1A1, ALDH1A2, and ALDH1A3 increased in the dorsal prostate, and ALDH1A3 decreased in the lateral prostate. atRA levels increased with the low activity of CYP2E1 and decreased with high CYP26 activity in the UChB dorsal prostate. Conversely, atRA was found to decrease when the activity of total CYP was increased in the UChA lateral prostate. Ethanol modulates the synthesis and catabolism of atRA in the prostate in a concentration-dependent manner.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Influence Of The Major Nitrite Transporter Nirc On The Virulence Of A Swollen Head Syndrome Avian Pathogenic E. Coli (apec) Strain.

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Surfactina: propriedades químicas, tecnológicas e funcionais para aplicações em alimentos

Surfactin, a lipopeptide produced by strains of Bacillus subtilis, has been proved to be a suitable biosurfactant in several applications. For many years, it has been investigated mainly for oil recovery and environmental usage. Its chemical, technological and functional characteristics turn surfactin into an attractive compound for several utilizations. In this review we emphasize some aspects of surfactin as a new food ingredient and its potential pharmaceutical and health applications.

Influência do processo de secagem na qualidade do cogumelo shiitake

Edible mushroom are highly perishable foods. Drying is an alternative to provide safe storage. In this work, the effects of some drying parameters on the quality of Shiitake mushroom were investigated: geometry of the raw material (whole and sliced), drying temperature (50 °C and 70 ºC) and final moisture content (5% and 15% wb). Experimental kinetics of drying was built and color and texture analyses were done in fresh and in rehydrated dried product. The effect of parameters was evaluated by analysis of variance and test of multiple comparisons. Drying kinetics showed that drying happened in falling-rate period and sliced mushroom dried at 70 ºC required lesser drying time than other treatments. Mushroom dried at 70 ºC showed less darkening. Drying time affected mushroom quality, evaluated by great hardness, gummosis and darkening.

Avaliação de estrutura de bambu como elemento construtivo para casa de vegetação

The use of technology to protect and produce vegetables and ornamental plants was developed over several adaptation phases that supported the demand for quality and amount of products. These developments also reduced production costs and climate damage to the crops. Many of these adaptations were carried out by farmers on their own initiative, using different materials and devices to solve their problems. This study was carried out at Agricultural Engineering College - Campinas University/UNICAMP, from December 2002 to January 2003, with the objective of evaluating the deformations of the constructive system of bamboo structure for greenhouses, submitted to different spacing among columns, and different vertical strains. It was tested the use of beams and columns built with bamboo stems from the specie Bambusa tuldoides Munro. The beams and columns were tied together with plastic spacing parts, specially designed to facilitate and standardize the construction of the building, providing more resistance and stability. Three column spaces (2.0, 2.5 and 3.0 m) were evaluated under different load strains. The best result was obtained with a spacing of 2.5 m.

Ocorrência de fungos filamentosos termo-resistentes em polpa de tomate envasada assepticamente

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Antibacterial activity of root canal filling materials for primary teeth: zinc oxide and eugenol cement, Calen paste thickened with zinc oxide, Sealapex and EndoREZ

This study evaluated in vitro the antibacterial activity of 4 root canal filling materials for primary teeth - zinc oxide and eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO), Sealapex sealer and EndoREZ sealer - against 5 bacterial strains commonly found in endodontic infections (Kocuria rhizophila, Enterococcus faecalis, Streptococcus mutans, Escherichia coli and Staphylococcus aureus) using the agar diffusion test (agar-well technique). Calen paste, 1% chlorhexidine digluconate (CHX) and distilled water served as controls. Seven wells per dish were made at equidistant points and immediately filled with the test and control materials. After incubation of the plates at 37oC for 24 h, the diameter of the zones of bacterial growth inhibition produced around the wells was measured (in mm) with a digital caliper under reflected light. Data were analyzed statistically by analysis of variance and Tukey's post-hoc test (?=0.05). There were statistically significant differences (p<0.0001) among the zones of bacterial growth inhibition produced by the different materials against all target microorganisms. K. rhizophila was inhibited more effectively (p<0.05) by ZOE, while Calen/ZO had its highest antibacterial activity against E. faecalis (p<0.05). S. mutans was inhibited by Calen/ZO, Sealapex and ZOE in the same intensity (p>0.05). E. coli was inhibited more effectively (p<0.05) by ZOE, followed by Calen/ZO and Sealapex. Calen/ZO and ZOE were equally effective (p>0.05) against S. aureus, while Sealapex had the lowest antibacterial efficacy (p<0.05) against this microorganism. EndoREZ presented antibacterial activity only against K. rhizophila and S. aureus. The Calen paste and Calen/ZO produced larger zones of inhibition than 1% CHX when the marker microorganism was E faecalis. In conclusion, the in vitro antibacterial activity of the 4 root canal filling materials for primary teeth against bacterial strains commonly found in endodontic infections can be presented in a decreasing order of efficacy as follows: ZOE>Calen/ZO>Sealapex>EndoREZ.

Antimicrobial efficacy of chemical disinfectants on contaminated full metal crowns

Prosthetic restorations that have been tried in the patient's mouth are potential sources of infection. In order to avoid cross-infection, protocols for infection control should be established in dental office and laboratory. This study evaluated the antimicrobial efficacy of disinfectants on full metal crowns contaminated with microorganisms. Full crowns cast in a Ni-Cr alloy were assigned to one control group (n=6) and 5 experimental groups (n=18). The crowns were placed in flat-bottom glass balloons and were autoclaved. A microbial suspension of each type of strain - S. aureus, P. aeruginosa, S. mutans, E. faecalis and C. albicans- was aseptically added to each experimental group, the crowns being allowed for contamination during 30 min. The contaminated specimens were placed into recipients with the chemical disinfectants (1% and 2% sodium hypochlorite and 2% glutaraldehyde) for 5, 10 and 15 min. Thereafter, the crowns were placed into tubes containing different broths and incubated at 35ºC. The control specimens were contaminated, immersed in distilled water for 20 min and cultured in Thioglycollate broth at 35ºC. Microbial growth assay was performed by qualitative visual examination after 48 h, 7 and 12 days. Microbial growth was noticed only in the control group. In the experimental groups, turbidity of the broths was not observed, regardless of the strains and immersion intervals, thus indicating absence of microbial growth. In conclusion, all chemical disinfectants were effective in preventing microbial growth onto full metal crowns.

Isolation of extraintestinal pathogenic Escherichia coli from diarrheic dogs and their antimicrobial resistance profile

From January to December 2006, 92 Escherichia coli isolates from 25 diarrheic dogs were analyzed by screening for the presence of adhesin-encoding genes (pap, sfa, afa), hemolysin and aerobactin genes. Virulence gene frequencies detected in those isolates were: 12% pap, 1% sfa, 10% hemolysin and 6.5% aerobactin. Ten isolates were characterized as extraintestinal pathogenic E. coli (ExPEC) strains; all showed a multidrug resistance phenotype that may represent a reason for concern due the risk of dissemination of antimicrobial resistant genes to the microbiota of human beings.

Occurrence of non-O157 Shiga toxin-producing Escherichia coli in dogs with diarrhea

Shiga toxigenic Escherichia coli (STEC) and Attaching and effacing E. coli (AEEC) have been associated with diarrhea illness in dogs. From January to December 2006, 92 E. coli isolates from 25 diarrheic dogs were analyzed, by screening for the presence of Shiga toxin-producing (stx 1 and stx 2) and intimin (eae) genes. Twelve isolates were detected by PCR to harbor the Shiga toxin genes (7 the stx 1 (7.6%); 5 the stx 2 (5.4%); and none both of them). Nine (9.8%) of the E. coli isolates studied were eae positive non Shiga toxin-producing. Thirteen (62.0%) isolates, carrying stx or eae gene, also showed a hemolysin production. The strains with virulence genes were also examined for resistance to 12 antimicrobial agents. Resistances to cephalothin (85.7%), streptomycin (81.0%), amoxicillin (71.4%) and gentamicin (71.4%) were predominantly observed.