Enzymatic Biodiesel Synthesis From Yeast Oil Using Immobilized Recombinant Rhizopus Oryzae Lipase.

The recombinant Rhizopus oryzae lipase (1-3 positional selective), immobilized on Relizyme OD403, has been applied to the production of biodiesel using single cell oil from Candida sp. LEB-M3 growing on glycerol from biodiesel process. The composition of microbial oil is quite similar in terms of saponifiable lipids than olive oil, although with a higher amount of saturated fatty acids. The reaction was carried out in a solvent system, and n-hexane showed the best performance in terms of yield and easy recovery. The strategy selected for acyl acceptor addition was a stepwise methanol addition using crude and neutralized single cell oil, olive oil and oleic acid as substrates. A FAMEs yield of 40.6% was obtained with microbial oils lower than olive oil 54.3%. Finally in terms of stability, only a lost about 30% after 6 reutilizations were achieved.

Photodynamic Antimicrobial Effects Of Bis-indole Alkaloid Indigo From Indigofera Truxillensis Kunth (leguminosae).

Multidrug-resistant microbial infections represent an exponentially growing problem affecting communities worldwide. Photodynamic therapy is a promising treatment based on the combination of light, oxygen, and a photosensitizer that leads to reactive oxygen species production, such as superoxide (type I mechanism) and singlet oxygen (type II mechanism) that cause massive oxidative damage and consequently the host cell death. Indigofera genus has gained considerable interest due its mutagenic, cytotoxic, and genotoxic activity. Therefore, this study was undertaken to investigate the effect of crude extracts, alkaloidal fraction, and isolated substance derived from Indigofera truxillensis in photodynamic antimicrobial chemotherapy on the viability of bacteria and yeast and evaluation of mechanisms involved. Our results showed that all samples resulted in microbial photoactivation in subinhibitory concentration, with indigo alkaloid presenting a predominant photodynamic action through type I mechanism. The use of CaCl2 and MgCl2 as cell permeabilizing additives also increased gram-negative bacteria susceptibility to indigo.

Molecular Diversity Of Fungal And Bacterial Communities In The Marine Sponge Dragmacidon Reticulatum.

The present work aimed to investigate the diversity of bacteria and filamentous fungi of southern Atlantic Ocean marine sponge Dragmacidon reticulatum using cultivation-independent approaches. Fungal ITS rDNA and 18S gene analyses (DGGE and direct sequencing approaches) showed the presence of representatives of three order (Polyporales, Malasseziales, and Agaricales) from the phylum Basidiomycota and seven orders belonging to the phylum Ascomycota (Arthoniales, Capnodiales, Dothideales, Eurotiales, Hypocreales, Pleosporales, and Saccharomycetales). On the other hand, bacterial 16S rDNA gene analyses by direct sequencing approach revealed the presence of representatives of seven bacterial phyla (Cyanobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Lentisphaerae, Chloroflexi, and Planctomycetes). Results from statistical analyses (rarefaction curves) suggested that the sampled clones covered the fungal diversity in the sponge samples studied, while for the bacterial community additional sampling would be necessary for saturation. This is the first report related to the molecular analyses of fungal and bacterial communities by cultivation-independent approaches in the marine sponges D. reticulatum. Additionally, the present work broadening the knowledge of microbial diversity associated to marine sponges and reports innovative data on the presence of some fungal genera in marine samples.

New Fefe-hydrogenase Genes Identified In A Metagenomic Fosmid Library From A Municipal Wastewater Treatment Plant As Revealed By High-throughput Sequencing.

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

The Influence Of The Buffering Capacity On The Production Of Organic Acids And Alcohols From Wastewater In Anaerobic Reactor.

Some bacteria common in anaerobic digestion process can ferment a broad variety of organic compounds to organic acids, alcohols, and hydrogen, which can be used as biofuels. Researches are necessary to control the microbial interactions in favor of the alcohol production, as intermediary products of the anaerobic digestion of organic compounds. This paper reports on the effect of buffering capacity on the production of organic acids and alcohols from wastewater by a natural mixed bacterial culture. The hypothesis tested was that the increase of the buffering capacity by supplementation of sodium bicarbonate in the influent results in benefits for alcohol production by anaerobic fermentation of wastewater. When the influent was not supplemented with sodium bicarbonate, the chemical oxygen demand (COD)-ethanol and COD-methanol detected in the effluent corresponded to 22.5 and 12.7 % of the COD-sucrose consumed. Otherwise, when the reactor was fed with influent containing 0.5 g/L of sodium bicarbonate, the COD-ethanol and COD-methanol were effluents that corresponded to 39.2 and 29.6 % of the COD-sucrose consumed. Therefore, the alcohol production by supplementation of the influent with sodium bicarbonate was 33.6 % higher than the fermentation of the influent without sodium bicarbonate.

Produção de isomaltulose, um substituto da sacarose, utilizando glicosiltransferase microbiana

Isomaltulose, a functional isomer of sucrose, is a non-cariogenic reducing disaccharide; has a low glycemic index; selectively promotes growth of beneficial bifidobacteria in the human intestinal microflora; and has greater stability than sucrose in some foods and beverages. Isomaltulose is a nutritional sugar that is digested more slowly than sucrose, and has health advantages for diabetics and nondiabetics. Immobilization techniques, especially entrapment of the cells, are widely used for conversion of sucrose into isomaltulose. Immobilization offers advantages such as minimum downstream processing, continuous operation and reusability of cells. Isomaltulose is currently considered to be a promising sugar substitute.

ESTUDO DA PREPARAÇÃO DOS EXTRATOS DE PRÓPOLIS E SUAS APLICAÇÕES

Ethanolic extracts from propolis were performed by using lhe water and vaflous coneentrations of etanol as solvent. The extracts were investigated by measurement of absorption spectruin with Uv-spectrophotometer (UV-scanning), reversed phase-high performance thin-layer chromatography, Reversed phase-HPLC. Maximum absorption of ali extracts was 290 nm, resembling flavonoid compounds and 80% ethanolic extract showed highest absorption at 290 nm. The most isosakuranetin, quercefin, and kaempferol were extracted from mixtures of propolis and 60% etanol, whereas 70% etanol extracted te most pinocembrin and sakuranetin, but 80% etanol extracted more kaempferide, acacetin, and isorhamnetin from propolis. The 60 to 80% ethanolic extracts ofpropolis inhibited highly to microbial growth and 70 and 80% ethanolic extracts showed lhe greatest antioxidant activity and 80% ethanolic extract inhibited highly to hyaluronidase activity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Clinical and antimicrobial efficacy of NitrAdineTM-based disinfecting cleaning tablets in complete denture wearers

OBJECTIVE: This study evaluated the efficacy of NitrAdineTM-based disinfecting cleaning tablets for complete denture, in terms of denture biofilm removal and antimicrobial action. MATERIAL AND METHODS: Forty complete denture wearers (14 men and 26 women) with a mean age of 62.3±9.0 years were randomly assigned to two groups and were instructed to clean their dentures according to two methods: brushing (control) - 3 times a day with denture brush and tap water following meals; brushing and immersion (Experimental) - brushing the denture 3 times a day with denture brush and tap water following meals and immersion of the denture in NitrAdineTM-based denture tablets (Medical InterporousTM). Each method was used for 21 days. Denture biofilm was disclosed by a 1% neutral red solution and quantified by means of digital photos taken from the internal surface before and after the use of the product. Microbiological assessment was conducted to quantify Candida sp. RESULTS: An independent t-test revealed a significant lower biofilm percentage for the experimental group (4.7, 95% CI 2.4 to 7.9) in comparison with the control group (mean 37.5, 95% CI 28.2 to 48.1) (t38=7.996, p<0.001). A significant reduction of yeast colony forming units could be found after treatment with Medical InterporousTM denture tablets as compared to the control group (Mann-Whitney test, Z=1.90; p<0.05). CONCLUSION: The present findings suggest that NitrAdineTM-based disinfecting cleaning tablets are efficient in removal of denture biofilm. In addition, a clear antimicrobial action was demonstrated. Therefore, they should be recommended as a routine denture maintenance method for the prevention of the development of microbial biofilm induced denture stomatitis.

Antimicrobial efficacy of chemical disinfectants on contaminated full metal crowns

Prosthetic restorations that have been tried in the patient's mouth are potential sources of infection. In order to avoid cross-infection, protocols for infection control should be established in dental office and laboratory. This study evaluated the antimicrobial efficacy of disinfectants on full metal crowns contaminated with microorganisms. Full crowns cast in a Ni-Cr alloy were assigned to one control group (n=6) and 5 experimental groups (n=18). The crowns were placed in flat-bottom glass balloons and were autoclaved. A microbial suspension of each type of strain - S. aureus, P. aeruginosa, S. mutans, E. faecalis and C. albicans- was aseptically added to each experimental group, the crowns being allowed for contamination during 30 min. The contaminated specimens were placed into recipients with the chemical disinfectants (1% and 2% sodium hypochlorite and 2% glutaraldehyde) for 5, 10 and 15 min. Thereafter, the crowns were placed into tubes containing different broths and incubated at 35ºC. The control specimens were contaminated, immersed in distilled water for 20 min and cultured in Thioglycollate broth at 35ºC. Microbial growth assay was performed by qualitative visual examination after 48 h, 7 and 12 days. Microbial growth was noticed only in the control group. In the experimental groups, turbidity of the broths was not observed, regardless of the strains and immersion intervals, thus indicating absence of microbial growth. In conclusion, all chemical disinfectants were effective in preventing microbial growth onto full metal crowns.

Isolation of Pseudomonas aeruginosa strains from dental office environments and units in Barretos, state of São Paulo, Brazil, and analysis of their susceptibility to antimicrobial drugs

A wide variety of opportunistic pathogens has been detected in the tubing supplying water to odontological equipment, in special in the biofilm lining of these tubes. Among these pathogens, Pseudomonas aeruginosa, one of the leading causes of nosocomial infections, is frequently found in water lines supplying dental units. In the present work, 160 samples of water, and 200 fomite samples from forty dental units were collected in the city of Barretos, State of São Paulo, Brazil and evaluated between January and July, 2005. Seventy-six P. aeruginosa strains, isolated from the dental environment (5 strains) and water system (71 strains), were tested for susceptibility to six antimicrobial drugs most frequently used against P. aeruginosa infections. Susceptibility to ciprofloxacin, followed by meropenem was the predominant profile. The need for effective means of reducing the microbial burden within dental unit water lines is emphasized, and the risk of exposure and cross-infection in dental practice, in special when caused by opportunistic pathogens like P. aeruginosa, are highlighted.

Maximum inhibitory dilution of mouthwashes containing chlorhexidine and polyhexamethylene biguanide against salivary staphylococcus aureus

OBJECTIVE: The aim of the present study was to determine the in vitro maximum inhibitory dilution (MID) of two chlorhexidinebased oral mouthwashes (CHX): Noplak®, Periogard®, and one polyhexamethylene biguanide-based mouthwash (PHMB): Sanifill Premium® against 28 field Staphylococcus aureus strains using the agar dilution method. MATERIALS AND METHODS: For each product, decimal dilutions ranging from 1/10 to 1/655,360 were prepared in distilled water and added to Mueller Hinton Agar culture medium. After homogenization, the culture medium was poured onto Petri dishes. Strains were inoculated using a Steers multipoint inoculator and dishes were incubated at 37ºC for 24hours. For reading, MID was considered as the maximum dilution of the mouthwash still capable of inhibiting microbial growth. RESULTS: Sanifill Premium® inhibited the growth of all strains at 1/40 dilution and of 1 strain at 1/80 dilution. Noplak® inhibited the growth of 23 strains at 1/640 dilution and of all 28 strains at 1/320 dilution. Periogard® showed inhibited growth of 7 strains at 1/640 dilution and of all 28 strains at 1/320 dilution. Data were submitted to Kruskal-Wallis statistical test, showing significant differences between the mouthwashes evaluated (p<0.05). No significant difference was found between Noplak® and Periogard® (p>0.05). Sanifill Premium® was the least effective (p<0.05). CONCLUSION: It was concluded that CHX-based mouthwashes present better antimicrobial activity against S. Aureus than the PHMB-based mouthwash.

Determination of the maximum inhibitory dilution of cetylpyridinium chloride-based mouthwashes against staphylococcus aureus: an in vitro study

The aim of this in vitro study was to determine the maximum inhibitory dilution (MID) of four cetylpyridinium chloride (CPC)-based mouthwashes: CPC+Propolis, CPC+Malva, CPC+Eucaliptol+Juá+Romã+Propolis (Natural Honey®) and CPC (Cepacol®), against 28 Staphylococcus aureus field strains, using the agar dilution method. Decimal dilutions ranging from 1/10 to 1/655,360 were prepared and added to Mueller Hinton Agar. Strains were inoculated using Steers multipoint inoculator. The inocula were seeded onto the surface of the culture medium in Petri dishes containing different dilutions of the mouthwashes. The dishes were incubated at 37ºC for 24 h. For readings, the MID was considered as the maximum dilution of mouthwash still capable of inhibiting microbial growth. The obtained data showed that CPC+Propolis had antimicrobial activity against 27 strains at 1/320 dilution and against all 28 strains at 1/160 dilution, CPC+Malva inhibited the growth of all 28 strains at 1/320 dilution, CPC+Eucaliptol+Juá+Romã+Propolis inhibited the growth of 2 strains at 1/640 dilution and all 28 strains at 1/320 dilution, and Cepacol® showed antimicrobial activity against 3 strains at 1/320 dilution and against all 28 strains at 1/160 dilution. Data were submitted to Kruskal-Wallis test, showing that the MID of Cepacol® was lower than that determined for the other products (p<0.05). In conclusion, CPC-mouthwashes showed antimicrobial activity against S. aureus and the addition of other substances to CPC improved its antimicrobial effect.

Carcass quality of feedlot finished steers fed yeast, monensin, and the association of both additives

To evaluate the effects of the supplementation of feed additives on carcass quality in beef cattle, 72 Nellore steers (339.5kg, 20-month old) were feedlot finished and fed for 91 days one of the following diets: 1) control with no additives; or added of 2) live yeast culture; 3) monensin; or 4) the association of both additives. After slaughter, renal, pelvic, and inguinal fat and hot carcass weights were recorded and carcass was split into muscle, bone, and trimmable fat. Carcass Longissimus muscle area and subcutaneous fat thickness at the 12th rib were measured and steaks of Longisimus muscle were taken to determine meat color, shear force, drip, and cooking losses. Yeast increased carcass dressing percentage but there were no effects on hot carcass weight, Longissimus area, subcutaneous fat thickness, percentage and weight of retail cut yield and trimmings. Feed additives had no effect on carcass pH, meat color, fat content, shear force, and drip losses. Supplementation of yeast, monensin or the association of both additives had no important effects on carcass traits and on meat quality of feedlot finished steers.

The mitochondrial genome of the stingless bee Melipona bicolor (Hymenoptera, Apidae, Meliponini): sequence, gene organization and a unique tRNA translocation event conserved across the tribe Meliponini

At present a complete mtDNA sequence has been reported for only two hymenopterans, the Old World honey bee, Apis mellifera and the sawfly Perga condei. Among the bee group, the tribe Meliponini (stingless bees) has some distinction due to its Pantropical distribution, great number of species and large importance as main pollinators in several ecosystems, including the Brazilian rain forest. However few molecular studies have been conducted on this group of bees and few sequence data from mitochondrial genomes have been described. In this project, we PCR amplified and sequenced 78% of the mitochondrial genome of the stingless bee Melipona bicolor (Apidae, Meliponini). The sequenced region contains all of the 13 mitochondrial protein-coding genes, 18 of 22 tRNA genes, and both rRNA genes (one of them was partially sequenced). We also report the genome organization (gene content and order), gene translation, genetic code, and other molecular features, such as base frequencies, codon usage, gene initiation and termination. We compare these characteristics of M. bicolor to those of the mitochondrial genome of A. mellifera and other insects. A highly biased A+T content is a typical characteristic of the A. mellifera mitochondrial genome and it was even more extreme in that of M. bicolor. Length and compositional differences between M. bicolor and A. mellifera genes were detected and the gene order was compared. Eleven tRNA gene translocations were observed between these two species. This latter finding was surprising, considering the taxonomic proximity of these two bee tribes. The tRNA Lys gene translocation was investigated within Meliponini and showed high conservation across the Pantropical range of the tribe.