996 resultados para Brazilian studies
Resumo:
OBJECTIVE: Study was to translate and culturally adapt the modified Rowe score for overhead athletes. METHODS: The translation and cultural adaptation process initially involved the stages of transla tion, synthesis, back-translation, and revision by the Translation Group. It was than created the pre-final version of the question naire, being the areas function and pain applied to 20 athletes that perform overhead movements and that suffered SLAP lesions in the dominant shoulder and the areas active compression test and anterior apprehension test and motion were applied to 15 health professionals. RESULTS: During the translation process there were made little modifications in the questionnaire in order to adapt it to Brazilian culture, without changing the semantics and the idiomatic concept originally described. CONCLUSIONS: The questionnaire was easily understood by the subjects of the study, being possible to obtain the Brazilian version of the modified Rowe score for over head athletes that underwent surgical treatment of the SLAP lesion.
Resumo:
The paper examines the recent trends of phonetic studies in Brazil, a productive area which analyses Brazilian-Portuguese data and contributes to phonetic theory. The central question discussed in the approach is the relationship between Phonetic and Phonology.
Resumo:
This paper traces the history of the study of pragmatics in Brazil. It is shown that Brazilian researches have, by and large, remained attentive to major developments in the field taking place elsewhere in the world. Of particular importance is the burgeoning tendency to focus attention on social issues affecting the day-to-day lives of ordinary people. More and more researchers are realizing the need to assume a critical role in relation to the theories they encounter in the literature.
Resumo:
This paper reintroduces the discussion about stress-timing in Brazilian Portuguese (BP). It begins by surveying some phonetic and phonological issues raised by the syllable- vs stress-timed dichotomy which culminated with the emergence of the p-center notion. Strict considerations of timing of V-V units and stress groups are taken into account to analyze the long term coupling of two basic oscillators (vowel and stress flow). This coupling allows a two-parameter characterization of language rhythms (coupling strength and speech rate) revealing that BP utterances present a high-degree of syllable-timing. A comparison with other languages, including European Portuguese, is also presented. The results analyzed indicate that Major's arguments for considering Portuguese (sic) as stress-timing are misleading.
Resumo:
The acquisition of Portuguese by two Brazilian children (aged 2;0 -5;0) is discussed in an attempt to describe and explain the first relative clauses produced in naturalistic, observational studies, according to the framework of generative syntax theory. The results show that at around 3;0: a) the child starts to deal with relative clauses as modifiers of N; b) cleft sentences appear before relative clauses, and c) the first relatives confirm the prevalence of the vernacular strategy of relativization in Brazilian Portuguese identified by other studies based on adult data.
Resumo:
This article aims at discussing and articulating views of language under sociocultural, dialogic and discourse perspectives, in order to present a theoretical framework as far as the analysis of textbooks of English as a foreign language for the Brazilian Ensino Fundamental I is concerned. Due to the limited number of studies in this field, to the still considerably structural approach of the English language teaching and learning in our country nowadays and to the important mediation role textbooks play in language education, we believe our work can contribute positively to the construction of critical and multiple literacies, which, in turn, can support an active and transformative educacional process in the present times.
Resumo:
Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This study analyses the national scientific production about college students' residence halls. The country's main data bases and electronic sites of several Brazilian higher education institutions were checked and 23 studies, published between 2000 and 2009, were found. The results of our analysis point to different focuses, which can be grouped into three categories: students who live in residence halls, residence halls themselves and actions for student assistance. Although there is large foreign scientific production about college student housing, the national production on this theme is still scarce, and the idea of student residence halls as educational spaces is still very incipient. The study points out to the need for investigating the living conditions in these places, and the impacts of this kind of habitation on students. Considering that student housing is an institutional responsibility, these studies potentially subsidize measures for proper educational conditions for college students.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.
Resumo:
INTRODUCTION: Subclinical hypothyroidism (SCH), defined as elevated concentrations of thyroid stimulating hormone (TSH) despite normal levels of thyroid hormones, is highly prevalent in Brazil, especially among women and the elderly. Although an increasing number of studies have related SCH to an increased risk of coronary artery disease and mortality, there have been no randomized clinical trials verifying the benefit of levothyroxine treatment in reducing these risks, and the treatment remains controversial. OBJECTIVE: This consensus, sponsored by the Thyroid Department of the Brazilian Society of Endocrinology and Metabolism and developed by Brazilian experts with extensive clinical experience with thyroid diseases, presents these recommendations based on evidence for the clinical management of SCH patients in Brazil. MATERIALS AND METHODS: After structuring the clinical questions, the search for evidence in the literature was initially performed in the MedLine-PubMed database and later in the Embase and SciELO - Lilacs databases. The strength of evidence was evaluated according to the Oxford classification system and established based on the experimental design used, considering the best available evidence for each question and the Brazilian experience. RESULTS: The topics covered included SCH definition and diagnosis, natural history, clinical significance, treatment and pregnancy, and the consensus issued 29 recommendations for the clinical management of adult patients with SCH. CONCLUSION: Treatment with levothyroxine was recommended for all patients with persistent SCH with serum TSH values > 10 mU/L and for certain patient subgroups.
Resumo:
Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.
Resumo:
A case of identical male twins with Cohen syndrome who present multiple ophthalmic findings is reported. The patients were identical 16 year-old twin boys who showed down slanting eyelids, mild ptosis, high-grade myopia, small cortical lens opacities, posterior subcapsular cataracts, myotic and corectopic pupils with poor dilation due to focal iris atrophy and retinochoroidal dystrophy. Ophthalmologists must be aware of the ocular and systemic findings of Cohen syndrome in the evaluation of young patients with mental retardation and visual impairment.
Resumo:
PURPOSE: To compare clinical trials published in Brazilian journals of ophthalmology and in foreign journals of ophthalmology with respect to the number of citations and the quality of reporting [by applying the Consolidated Standards for Reporting Trials (CONSORT) statement writing standards]. METHODS: The sample of this systematic review comprised the two Brazilian journals of ophthalmology indexed at Science Citation Index Expanded and six of the foreign journals of ophthalmology with highest Impact Factor® according ISI. All clinical trials (CTs) published from January 2009 to December 2010 at the Brazilians journals and a 1:1 randomized sample of the foreign journals were included. The primary outcome was the number of citations through the end of 2011. Subgroup analysis included language. The secondary outcome included likelihood of citation (cited at least once versus no citation), and presence or absence of CONSORT statement indicators. RESULTS: The citation counts were statistically significantly higher (P<0.001) in the Foreign Group (10.50) compared with the Brazilian Group (0.45). The likelihood citation was statistically significantly higher (P<0.001) in the Foreign Group (20/20 - 100%) compared with the Brazilian Group (8/20 - 40%). The subgroup analysis of the language influence in Brazilian articles showed that the citation counts were statistically significantly higher in the papers published in English (P<0.04). Of 37 possible CONSORT items, the mean for the Foreign Group was 20.55 and for the Brazilian Group was 13.65 (P<0.003). CONCLUSION: The number of citations and the quality of reporting of clinical trials in Brazilian journals of ophthalmology still are low when compared with the foreign journals of ophthalmology with highest Impact Factor®.