Removal from the Membrane Affects the Interaction of Rat Osseous Plate Ecto-Nucleosidetriphosphate Diphosphohydrolase-1 with Substrates and Ions

We have characterized the kinetic properties of ectonucleoside triphosphate diphosphohydrolase 1 (E-NTPDase1) from rat osseous plate membranes. A novel finding of the present study is that the solubilized enzyme shows high- and low-affinity sites for the substrate in contrast with a single substrate site for the membrane-bound enzyme. In addition, contrary to the Michaelian chraracteristics of the membrane-bound enzyme, the site-site interactions after solubilization with 0.5% digitonin plus 0.1% lysolecithin resulted in a less active ectonucleoside triphosphate diphosphohydrolase, showing activity of about 398.3 nmol Pi min(-1) mg(-1). The solubilized enzyme has M(r) of 66-72 kDa, and its catalytic efficiency was significantly increased by magnesium and calcium ions; but the ATP/ADP activity ratio was always < 2.0. Partial purification and kinetic characterization of the rat osseous plate E-NTPDase1 in a solubilized form may lead to a better understanding of a possible function of the enzyme as a modulator of nucleotidase activity or purinergic signaling in matrix vesicle membranes. The simple procedure to obtain the enzyme in a solubilized form may also be attractive for comparative studies of particular features of the active sites from this and other ATPases.

Shared structural determinants for the calcium-independent liposome membrane permeabilization and sarcolemma depolarization in Bothropstoxin-I, a LYS49-PLA(2) from the venom of Bothrops jararacussu

The structural determinants of myotoxicity of bothropstoxin-I (BthTX-I), a Lys49 phospholipase A(2) from Bothrops jararacussu venom, were studied by measuring the resting membrane potential in the mouse phrenic nerve-diaphragm preparation. This method proved to be around 100-fold more sensitive than the creatine kinase release assay, and was used to evaluate a total of 31 site-directed BthTX-I alanine scanning mutants. Mutants that reduced the resting membrane potential were located in a surface patch defined by residues in the C-terminal loop (residues 115-129), positions 37-39 in the membrane interfacial recognition surface (Y46 and K54), and residue K93. These results expand the known structural determinants of the biological activity as evaluated by previous creatine kinase release experiments. Furthermore, a strong correlation is observed between the structural determinants of sarcolemma depolarization and calcium-independent disruption of liposome membranes, suggesting that a common mechanism of action underlies the permeabilization of the biological and model membranes. (C) 2009 Elsevier Ltd. All rights reserved.

Translational incorporation of L-3,4-dihydroxyphenylalanine into proteins

An Escherichia coli cell-free transcription/translation system was used to explore the high-level incorporation Of L-3,4-dihydroxyphenylalanine (DOPA) into proteins by replacing tyrosine with DOPA in the reaction mixtures. ESI-MS showed specific incorporation of DOPA in place of tyrosine. More than 90% DOPA incorporation at each tyrosine site was achieved, allowing the recording of clean N-15-HSQC NMR spectra. A redox-staining method specific for DOPA was shown to provide a sensitive and generally applicable method for assessing the cell-free production of proteins. Of four proteins produced in soluble form in the presence of tyrosine, two resulted in insoluble aggregates in the presence of high levels of DOPA. DOPA has been found in human proteins, often in association with various disease states that implicate protein aggregation and/or misfolding. Our results suggest that misfolded and aggregated proteins may result, in principle, from ribosome-mediated misincorporation of intracellular DOPA accumulated due to oxidative stress. High-yield cell-free protein expression systems are uniquely suited to obtain rapid information on solubility and aggregation of nascent polypeptide chains.

Effect of hypothalamo-pituitary disconnection on the development of anterior pituitary cells in late gestation ovine fetuses

The specific role of the hypothalamus in regulating the developmental profile of anterior pituitary (AP) cells remains largely unknown. The present study evaluated hypothalamic contributions to AP cell development, utilizing the technique of hypothalamo-pituitary disconnection (HPD). HPD of fetal sheep or sham surgery was performed at 110 days gestation (d) (n=6 each group; term ~ 147d). Fetuses were removed and pituitaries collected at 110d (no surgery; n=6) or 141d (sham and HPD groups). The impact of HPD on AP cell development was assessed by single-labeled immunofluorescence for five hormones to identify proportions of AP cells expressing each hormone. HPD was associated with a 70% increase (P

Giant protein kinases: Domain interactions and structural basis of autoregulation

The myosin-associated giant protein kinases twitchin and titin are composed predominantly of fibronectin- and immunoglobulin-like modules, We report the crystal structures of two autoinhibited twitchin kinase fragments, one from Aplysia and a larger fragment from Caenorhabditis elegans containing an additional C-terminal immunoglobulin-like domain, The structure of the longer fragment shoes that the immunoglobulin domain contacts the protein kinase domain on the opposite side from the catalytic cleft, laterally exposing potential myosin binding residues, Together, the structures reveal the cooperative interactions between the autoregulatory region and the residues from the catalytic domain involved in protein substrate binding, ATP binding, catalysis and the activation loop, and explain the differences between the observed autoinhibitory mechanism and the one found in the structure of calmodulin-dependent kinase I.

Binding and internalization of the melanocyte stimulating hormone receptor ligand [Nle(4), D-Phe(7)]alpha-MSH in B16 melanoma cells

The current study aims to ascertain the fate of the melanocyte stimulating hormone (MSH) receptor and its ligand [Nle(4), D-Phe(7)]alpha-MsH (NDP-MSH) following binding to murine B16 melanoma cells. Cells were incubated with [I-125]-NDP-MSH for up to 180 min and binding, internalization and degradation determined. Intracellular trafficking of the radiolabel was assessed !using Percoll density gradient centrifugation of homogenized cells. Receptor down-regulation and receptor mRNA levels were also measured over 96 hr after exposure to 1 mu M ligand. NDP-MSH accumulation increased with time in a temperature-dependent manner and was inhibited by excess peptide. The ligand was rapidly internalized and translocated to the lysosomal compartment where it was degraded. Internalization was accompanied by a loss or down-regulation of cell surface receptors, suggesting internalization of the NDP-MSH-receptor complex. No recycling of the receptors between the plasma membrane and intracellular compartments could be detected in this cell-hue. Approximately 15% of the surface receptors were resistant to down-regulation, possibly indicating receptor heterogeneity. Down-regulation persisted ibr up to 96 hr and was accompanied by a decrease in MSH receptor mRNA levels 48 hr after treatment. However, before this time, transcript levels were the same in treated and control cells. In contrast to what was seen with NDP-MSH, cell surface receptors removed with trypsin wc:re rapidly replaced. These results show that NDP-MSH not only induced MSH receptor :internalization but also inhibited receptor turnover, resulting in a prolonged down-regulation. It is concluded that, in B16 cells, the MSH receptor undergoes ligand-dependent internalization, resulting in a prolonged down-regulation. Copyright (C) 1996 Elsevier Science Ltd

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Estradiol`s Salutary Effects on Keratinocytes Following Trauma-Hemorrhage Are Mediated by Estrogen Receptor (ER)-alpha and ER-beta

Although administration of 17 beta-estradiol (estrogen) following trauma-hemorrhage attenuates the elevation of cytokine production and mitogen-activated protein kinase (MAPK) activation in epidermal keratinocytes, whether the salutary effects of estrogen are mediated by estrogen receptor (ER)-alpha. or ER-beta is not known. To determine which estrogen receptor is the mediator, we subjected C3H/HeN male mice to trauma-hemorrhage (2-cm midline laparotomy and bleeding of the animals to a mean blood pressure of 35 mmHg and maintaining that pressure for 90 min) followed by resuscitation with Ringer`s lactate (four times the shed blood volume) At the middle of resuscitation we subcutaneously injected ER-alpha agonist propyl pyrazole trial (PPT; 5 mu g/kg), ER-beta agonist diarylpropionitrile (DPN; 5 mu g/kg), estrogen (50 mu g/kg), or ER antagonist ICI 182,780 (150 mu g/kg). Two hours after resuscitation, we isolated keratinocytes, stimulated them with lipopolysaccharide for 24 In (5 mu g/mL for maximum cytokine production), and measured the production of interleukin (IL)-6, IL-10, IL-12, and INF-alpha and the activation of MAPK. Keratinocyte cytokine production markedly increased and MAPK activation occurred following trauma-hemorrhage but were normalized by administration of estrogen, PPT and DPN. PPT and DPN administration were equally effective in normalizing the inflammatory response of keratinocytes, indicating that both ER-alpha. and ER-beta mediate the salutary effects of estrogen on kerotinocytes after trauma-hemorrhage.

Drugs in the acute porphyrias - Toxicogenetic diseases

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.

Neutrophils recruitment during sepsis: Critical points and crossroads

The mechanisms that initiate an inflammatory systemic response to a bacterial infection lead to a high mortality and constitute the first cause of death in Critical Care Units (ICU`s). Sepsis is a poorly understood disease and despite life support techniques and the administration of antibiotics, not much more can be done to improve its diagnosis and treatment. The present article has as main objective to discuss the role of neutrophils recruitment in sepsis, dissecting the molecular mechanisms implicated in this complex process and its importance to the pathogenesis of this outstanding cause of death.

Interleukin-1 receptor antagonist gene (IL1RN) polymorphism possibly associated to severity of rheumatic carditis in a Brazilian cohort

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.