Encephalization And Diversification Of The Cranial Base In Platyrrhine Primates.

The cranial base, composed of the midline and lateral basicranium, is a structurally important region of the skull associated with several key traits, which has been extensively studied in anthropology and primatology. In particular, most studies have focused on the association between midline cranial base flexion and relative brain size, or encephalization. However, variation in lateral basicranial morphology has been studied less thoroughly. Platyrrhines are a group of primates that experienced a major evolutionary radiation accompanied by extensive morphological diversification in Central and South America over a large temporal scale. Previous studies have also suggested that they underwent several evolutionarily independent processes of encephalization. Given these characteristics, platyrrhines present an excellent opportunity to study, on a large phylogenetic scale, the morphological correlates of primate diversification in brain size. In this study we explore the pattern of variation in basicranial morphology and its relationship with phylogenetic branching and with encephalization in platyrrhines. We quantify variation in the 3D shape of the midline and lateral basicranium and endocranial volumes in a large sample of platyrrhine species, employing high-resolution CT-scans and geometric morphometric techniques. We investigate the relationship between basicranial shape and encephalization using phylogenetic regression methods and calculate a measure of phylogenetic signal in the datasets. The results showed that phylogenetic structure is the most important dimension for understanding platyrrhine cranial base diversification; only Aotus species do not show concordance with our molecular phylogeny. Encephalization was only correlated with midline basicranial flexion, and species that exhibit convergence in their relative brain size do not display convergence in lateral basicranial shape. The evolution of basicranial variation in primates is probably more complex than previously believed, and understanding it will require further studies exploring the complex interactions between encephalization, brain shape, cranial base morphology, and ecological dimensions acting along the species divergence process.

Photocatalytic Degradation Of Ofloxacin And Evaluation Of The Residual Antimicrobial Activity.

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Scaphoid Fracture Nonunion: Correlation Of Radiographic Imaging, Proximal Fragment Histologic Viability Evaluation, And Estimation Of Viability At Surgery: Diagnosis Of Scaphoid Pseudarthrosis.

The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.

Trends and strategies of ozone application in environmental problems

Efforts presented by the scientific community in recent years towards the development of numerous green chemical processes and wastewater treatment technologies are presented and discussed. In the light of these approaches, environmentally friendly technologies, as well as the key role played by the well-known advanced oxidation processes, are discussed, giving special attention to the ones comprising ozone applications. Fundamentals and applied aspects dealing with ozone technology and its application are also presented.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Multifunctional role of steroidogenic factor 1 and disorders of sex development

Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.

Sensitivity and specificity of machine learning classifiers for glaucoma diagnosis using Spectral Domain OCT and standard automated perimetry

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

Torcidas organizadas e seus jovens torcedores : diversidades e normativas do torcer = Torcidas organizadas and their young supporters : diversities and normatives of supporting

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia do esporte : organização, sistematização, aplicação e avaliação de conteúdos esportivos na educação não formal = Sport pedagogy : organization, systematization and application of sports content in non-formal education

Universidade Estadual de Campinas . Faculdade de Educação Física

Democracia Corinthiana : sentidos e significados da participação dos jogadores = Corinthians democracy : meanings and significance of the players' participation

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho muscular do quadríceps e dos isquiotibiais em função da série temporal e da amplitude de movimento de atletas amadoras de futsal feminino = : Analysis of muscle performance of the quadriceps and hamstrings as a function of the times series and range of motion of amateurfemale futsal athletes

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física