950 resultados para detection-by-tracking
Resumo:
The Deep Underground Neutrino Experiment (DUNE) is a long-baseline accelerator experiment designed to make a significant contribution to the study of neutrino oscillations with unprecedented sensitivity. The main goal of DUNE is the determination of the neutrino mass ordering and the leptonic CP violation phase, key parameters of the three-neutrino flavor mixing that have yet to be determined. An important component of the DUNE Near Detector complex is the System for on-Axis Neutrino Detection (SAND) apparatus, which will include GRAIN (GRanular Argon for Interactions of Neutrinos), a novel liquid Argon detector aimed at imaging neutrino interactions using only scintillation light. For this purpose, an innovative optical readout system based on Coded Aperture Masks is investigated. This dissertation aims to demonstrate the feasibility of reconstructing particle tracks and the topology of CCQE (Charged Current Quasi Elastic) neutrino events in GRAIN with such a technique. To this end, the development and implementation of a reconstruction algorithm based on Maximum Likelihood Expectation Maximization was carried out to directly obtain a three-dimensional distribution proportional to the energy deposited by charged particles crossing the LAr volume. This study includes the evaluation of the design of several camera configurations and the simulation of a multi-camera optical system in GRAIN.
Resumo:
Flavanones (hesperidin, naringenin, naringin, and poncirin) in industrial, hand-squeezed orange juices and from fresh-in-squeeze machines orange juices were determined by HPLC/DAD analysis using a previously described liquid-liquid extraction method. Method validation including the accuracy was performed by using recovery tests. Samples (36) collected from different Brazilian locations and brands were analyzed. Concentrations were determined using an external standard curve. The limits of detection (LOD) and the limits of quantification (LOQ) calculated were 0.0037, 1.87, 0.0147, and 0.0066 mg 100 g(-1) and 0.0089, 7.84, 0.0302, and 0.0200 mg 100 g(-1) for naringin, hesperidin, poncirin, and naringenin, respectively. The results demonstrated that hesperidin was present at the highest concentration levels, especially in the industrial orange juices. Its average content and concentration range were 69.85 and 18.80-139.00 mg 100 g(-1). The other flavanones showed the lowest concentration levels. The average contents and concentration ranges found were 0.019, 0.01-0.30, and 0.12 and 0.1-0.17, 0.13, and 0.01-0.36 mg 100 g(-1), respectively. The results were also evaluated using the principal component analysis (PCA) multivariate analysis technique which showed that poncirin, naringenin, and naringin were the principal elements that contributed to the variability in the sample concentrations.
Resumo:
This clinical study has investigated the antigenic activity of bacterial contents from exudates of acute apical abscesses (AAAs) and their paired root canal contents regarding the stimulation capacity by levels of interleukin (IL)-1 beta and tumor necrosis factor alpha (TNF-α) throughout the root canal treatment against macrophage cells. Paired samples of infected root canals and exudates of AAAs were collected from 10 subjects. Endodontic contents were sampled before (root canal sample [RCS] 1) and after chemomechanical preparation (RCS2) and after 30 days of intracanal medication with calcium hydroxide + chlorhexidine gel (Ca[OH]2 + CHX gel) (RCS3). Polymerase chain reaction (16S rDNA) was used for detection of the target bacteria, whereas limulus amebocyte lysate was used to measure endotoxin levels. Raw 264.7 macrophages were stimulated with AAA exudates from endodontic contents sampled in different moments of root canal treatment. Enzyme-linked immunosorbent assays were used to measure the levels of TNF-α and IL-1 beta. Parvimonas micra, Porphyromonas endodontalis, Dialister pneumosintes, and Prevotella nigrescens were the most frequently detected species. Higher levels of endotoxins were found in samples from periapical exudates at RCS1 (P < .005). In fact, samples collected from periapical exudates showed a higher stimulation capacity at RCS1 (P < .05). A positive correlation was found between endotoxins from exudates with IL-1 beta (r = 0.97) and TNF-α (r = 0.88) production (P < .01). The significant reduction of endotoxins and bacterial species achieved by chemomechanical procedures (RCS2) resulted in a lower capacity of root canal contents to stimulate the cells compared with that at RCS1 (P < .05). The use of Ca(OH)2 + CHX gel as an intracanal medication (RCS3) improved the removal of endotoxins and bacteria from infected root canals (P < .05) whose contents induced a lower stimulation capacity against macrophages cells at RCS1, RCS2, and RCS3 (P < .05). AAA exudates showed higher levels of endotoxins and showed a greater capacity of macrophage stimulation than the paired root canal samples. Moreover, the use of intracanal medication improved the removal of bacteria and endotoxins from infected root canals, which may have resulted in the reduction of the inflammatory potential of the root canal content.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
An HPLC-PAD method using a gold working electrode and a triple-potential waveform was developed for the simultaneous determination of streptomycin and dihydrostreptomycin in veterinary drugs. Glucose was used as the internal standard, and the triple-potential waveform was optimized using a factorial and a central composite design. The optimum potentials were as follows: amperometric detection, E1=-0.15V; cleaning potential, E2=+0.85V; and reactivation of the electrode surface, E3=-0.65V. For the separation of the aminoglycosides and the internal standard of glucose, a CarboPac™ PA1 anion exchange column was used together with a mobile phase consisting of a 0.070 mol L(-1) sodium hydroxide solution in the isocratic elution mode with a flow rate of 0.8 mL min(-1). The method was validated and applied to the determination of streptomycin and dihydrostreptomycin in veterinary formulations (injection, suspension and ointment) without any previous sample pretreatment, except for the ointments, for which a liquid-liquid extraction was required before HPLC-PAD analysis. The method showed adequate selectivity, with an accuracy of 98-107% and a precision of less than 3.9%.
Resumo:
Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.995
Resumo:
A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Conventional radiography has shown limitation in acquiring image of the ATM region, thus, computed tomography (CT) scanning has been the best option to the present date for diagnosis, surgical planning and treatment of bone lesions, owing to its specific properties. OBJECTIVE: The aim of the study was to evaluate images of simulated bone lesions at the head of the mandible by multislice CT. MATERIAL AND METHODS: Spherical lesions were made with dental spherical drills (sizes 1, 3, and 6) and were evaluated by using multislice CT (64 rows), by two observers in two different occasions, deploying two protocols: axial, coronal, and sagittal images, and parasagittal images for pole visualization (anterior, lateral, posterior, medial and superior). Acquired images were then compared with those lesions in the dry mandible (gold standard) to evaluate the specificity and sensibility of both protocols. Statistical methods included: Kappa statistics, validity test and chi-square test. Results demonstrated the advantage of associating axial, coronal, and sagittal slices with parasagittal slices for lesion detection at the head of the mandible. RESULTS: There was no statistically significant difference between the types of protocols regarding a particular localization of lesions at the poles. CONCLUSIONS: Protocols for the assessment of the head of the mandible were established to improve the visualization of alterations of each of the poles of the mandible's head. The anterior and posterior poles were better visualized in lateral-medial planes while lateral, medial and superior poles were better visualized in the anterior-posterior plane.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
A simple and low cost method to determine volatile contaminants in post-consumer recycled PET flakes was developed and validated by Headspace Dynamic Concentration and Gas Chromatography-Flame Ionization Detection (HDC-GC-FID). The analytical parameters evaluated by using surrogates include: correlation coefficient, detection limit, quantification limit, accuracy, intra-assay precision, and inter-assay precision. In order to compare the efficiency of the proposed method to recognized automated techniques, post-consumer PET packaging samples collected in Brazil were used. GC-MS was used to confirm the identity of the substances identified in the PET packaging. Some of the identified contaminants were estimated in the post-consumer material at concentrations higher than 220 ng.g-1. The findings in this work corroborate data available in the scientific literature pointing out the suitability of the proposed analytical method.