1000 resultados para citotoxicicidade em linhagens celulares humanas


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Isolados de Botrytis cinerea foram avaliados quanto a sensibilidade a benomyl, ipridione e propiconazol, através do método do fungicida incorporado ao meio de cultura de BDA. Os isolados de B. cinerea foram coletados em cultivos comerciais de cebola, berinjela, morango, crisântemo, batata, e roseira, em diversas localidades do estado de São Paulo. Em cultivos em estufa, foram obtidos isolados de roseira, ciclame, violeta, begonia, pimentão e cultivo hidropônico de tomate cereja. Os resultados demonstraram que esta ocorrendo uma reducao na sensibilidade aos fungicidas testados, especialmente ao benomyl e ipridione, em condições de estufa, quando analisados os valores de ED50 (dose de fungicida suficiente para inibir 50% do crescimento micelial) e MIC (concentracao mínima inibitória. De modo geral, esta ocorrendo uma redução na adaptabilidade das linhagens avaliadas através da taxa diária de crescimento micelial.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper tries to show that the developments in linguistic sciences are better viewed as stages in a single research program, rather than different ideological -isms. The first part contains an overview of the structuralistas' beliefs about the universality and equivalence of human languages, and their search for syntactic universals. In the second part, we will see that the generative program, in its turn, tries to answer why language is a universal faculty in the human species and addresses questions about its form, its development and its use. In the second part, we will see that the paper gives a brief glimpse of the tentative answers the program has been giving to each of these issues.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper aims to discuss the future -- and the proper survival of Textlinguistics this millenium, and the challenges it has to face in order to contribute to the development of Human Sciences in a new era.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work indicates presuppositions for the qualitative research in Physical Education, starting with a literature review based on the cultural frame of reference. Firstly, we introduce the debate concerning the natural and the human sciences and implications for the Physical Education; we then use a cultural axis as a ground basis for the research in the area, proposing the 'dense description' as a possibility for knowledge building; finally, we bring up examples of studies conducted with such an approach. This theoretical methodological approach allows the study of the human being as a cultural being, thus opposed to the naturalised view of a human - predominant in Physical Education.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aflatoxins are hepatotoxic metabolites produced by Aspergillus flavus and A. parasiticus on a number of agricultural commodities. This research was carried out to evaluate the ability of thermolysed and active Saccharomyces cerevisiae to attenuate liver damage caused by aflatoxin. Diets were prepared containing 0 aflatoxin; 400 mug kg-1 aflatoxin; 400 mug kg-1 aflatoxin plus 1% of dehydrated active yeast, and 400 mug kg-1 aflatoxin plus 1% of thermolysed yeast. A bioassay with Wistar rats was conducted for 28 days, and body organs were weighted and analyses of the liver tissue of the animals were performed. The relative weight of heart, kidneys and liver from animals submitted to the different treatments did not show any difference, and liver tissue of animals feeding on the aflatoxin-free diet was adopted as a toxicity-free pattern. Hepatic tissue of animals feeding on diets containing 400 mug kg-1 aflatoxin or the diet supplemented with 1% thermolysed yeast showed clear signs of toxicity and damage. Hepatic tissue of animals feeding on the diet containing 1% of dehydrated active yeast showed less toxicity signs and damage than those receiving the diet containing 400 mug kg-1 aflatoxin. Active, dehydrated yeast had the ability to reduce toxic effects caused by aflatoxin, but thermolysed yeast was not able to alleviate the effects of aflatoxin toxicity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física