Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Physical and chemical properties of wami tilapia skin gelatin

Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.

Study of thermodynamic water properties and moisture sorption hysteresis of mango skin

The equilibrium moisture content for adsorption and desorption isotherms of mango skin was determined using the static gravimetric method at temperatures of 20, 26, 33, 38 and 44 oC in the 0.056 to 0.873 water activity range. Both sorption curves show a decrease in equilibrium moisture content as the temperature increasing. The hysteresis effect was observed at constant water activity. The Guggenheim, Anderson, and de Boer (GAB) model presented the best fitting accuracy among a group of models and was used to determine the thermodynamic properties of water sorption. Integral enthalpy and integral entropy areas showed inverted values for the adsorption and desorption isotherms over the wide range of water activity studied. These values confirm, in energetic terms, the difference between adsorption and desorption isotherms observed in the hysteresis phenomenon. Finally, the Gibbs free energy revealed that the sorption process was spontaneous for both sorption isotherms.

Stretching the drum skin : an analysis of power relations in leadership and succession in the Evangelical Lutheran church in Tanzania-Northern diocese 1942– 1993

-

Living in the Skin That I Am: An Organizational Autoethnography of an Adult Educator's Plight to Survive the Stigma of Invisible and Episodic Disability in an Academy of Administritiva

Through the reflective lens of an adult educator with invisible and episodic disabilities, this paper has been written as an organizational autoethnography. Through a process of autoethnographical sensemaking, it is intended to illuminate important gaps in organizational theory. Feminist/relational care ethics, critical reflection, and transformative learning serve as the educational theories that comprise its framework. In telling my story, embodied writing and performance narrative are used to convey the felt existence of a body exposed through words—where my “abled” and “disabled” professional teaching and learning identities may be studied against the backdrop of organizational policies and procedures. Words used to describe unfamiliar experiences and situations shape meaning for which new meaning may emerge. At the conclusion of this paper, an alternative frame of reference—a view from the margins—may be offered to articulate authenticity in the expectancy of workplace equity for adult educators with disabilities. Taken collectively on a larger level, it is hoped that this research may provide a source of inspiration for systemic organizational change in adult learning environments.

Examining the roles of core and local temperature on forearm skin blood flow

The interaction between local and reflexive control of skin blood flow (SkBF) is unclear. This thesis isolated the roles of rectal (Tre) and local (Tloc) temperature on forearm SkBF regulation at normal and elevated body temperatures, and to investigate the interaction between local and reflexive SkBF control. While either normothermic (Tre ~37.0°C) or hyperthermic (∆Tre +1.1°C), SkBF was assessed on the dorsal aspect of each forearm in 10 participants while Tloc was manipulated in an A-B-A-B fashion between neutral (33.0°C) and hot (38.5°C). Finally, local heating to 44°C was performed to elicit maximal SkBF. Data are presented as a percentage of maximal cutaneous vascular conductance (CVC), calculated as laser-Doppler flux divided by mean arterial pressure. Tloc manipulations performed during normothermia had significantly greater effects on CVC than during hyperthermia. The decreased modification to SkBF from the Tloc changes during hyperthermia suggests that strong reflexive vasodilation attenuates local SkBF control mechanisms.

Registered Nurses' Perceptions about Facilitators and Barriers to Maternal Skin to Skin Contact in the Operating Room

Abstract It is recommended that all new mothers experience skin-to-skin contact (SSC) with their newborns immediately after birth. However, SSC is not commonly practiced after cesarean deliveries. To understand facilitators and barriers regarding SSC in the operating room (OR), a descriptive online and paper survey was conducted with 68 Registered Nurses from four hospitals in Ontario. The theory of planned behavior framed the study. Nurses had positive attitudes, and believed most health care team members supported SSC in the OR, but were uncertain about their control over the behavior. Nurses who had practiced the behavior in the past had more positive attitudinal and normative beliefs, and perceived some barriers as less difficult. Attitude and past behavior were the only significant multivariate predictors of intention to practice SSC in the future. Results suggest that shifting attitude and supporting more experience with the practice may increase nurses’ implementation of SSC in the OR.

Optimization of Process Parameters for the Extraction of Gelatin from the Skin of Freshwater Fish and the Evaluation of Physical anal Chemical Characteristics

Faculty of Marine Sciences,Cochin University of Science and Technology

Biochemical Characterization and Bio-evaluation of Collagen and Collagen Peptides Extracted and Purified from Fish Skin: In vitro and In vivo Studies on Antiarthritic and Wound Healing Properties

In fish processing plants, there is huge amount of skin that is left as the waste. When this skin is taken and processed into fish collagen, it will save large amount of money that is used for extraction of collagen from other animal s.Fish collagen can be used as an alternative to replace mammalian collagen, especially collagen extracted from bovine, when we consider the outbreak of bovine spongiform encephalopathy (BSE), transmissible spongiform encephalopathy (TSE) and the foot - and-mouth disease (FMD) issues. BSE and TSE are progressive neurological disorders affecting cattles caused by proteinacious infectious particles called prions.The study aims in producing collagen that has been extracted from fish skin to replace other animal collagen so as to overcome the problem of other animal collagen issues. Also the study utilized the abandoned fish waste produced by fish processing industry since bone, skin, fin and scales of fish can be a useful source of collagen.

Vesicular systems for delivering conventional small organic molecules and larger macromolecules to and through human skin

The history of using vesicular systems for drug delivery to and through skin started nearly three decades ago with a study utilizing phospholipid liposomes to improve skin deposition and reduce systemic effects of triamcinolone acetonide. Subsequently, many researchers evaluated liposomes with respect to skin delivery, with the majority of them recording localized effects and relatively few studies showing transdermal delivery effects. Shortly after this, Transfersomes were developed with claims about their ability to deliver their payload into and through the skin with efficiencies similar to subcutaneous administration. Since these vesicles are ultradeformable, they were thought to penetrate intact skin deep enough to reach the systemic circulation. Their mechanisms of action remain controversial with diverse processes being reported. Parallel to this development, other classes of vesicles were produced with ethanol being included into the vesicles to provide flexibility (as in ethosomes) and vesicles were constructed from surfactants and cholesterol (as in niosomes). Thee ultradeformable vesicles showed variable efficiency in delivering low molecular weight and macromolecular drugs. This article will critically evaluate vesicular systems for dermal and transdermal delivery of drugs considering both their efficacy and potential mechanisms of action.

The use of gaseous ozone and gas packaging to control populations of Salmonella infantis and Pseudomonas aeruginosa on the skin of chicken portions

Chilled breasts of chicken were inoculated with Salmonella infantis or Pseudomonas aeruginosa and then given one of the following treatments: (i) exposure to gaseous ozone (>2000 ppm for up to 30 min); (ii) storage under 70% CO2:30% N-2; and (iii) exposure to gaseous ozone (>2000 ppm for 15 min) followed by storage under 70% CO2:30% N-2; all storage at 7degreesC. Gaseous ozone reduced the counts of samnonellae by 97(Y,, and pseudomonads by 95%, but indigenous coliforms were unaffected. Under the modified atmosphere, the cell count of S. infantis was reduced by 72% following initial exposure and then stabilised, coliforms grew, but Ps. aeruginosa behaved like S. infantis-initial reduction (58%) followed by stability. Exposure to gaseous ozone followed by gas packaging allowed survival of S. infantis, Ps. aeruginosa and coliforms over 9 days at 7degreesC, but there was no evidence of any sensory deterioration. It is proposed that the latter treatment could, in a modified form perhaps, be used to reduce the contamination of chicken carcasses with salmonellae and improve their shelf-life. (C) 2004 Elsevier Ltd. All rights reserved.