Els Almogàvers: Les cares d'un mite.

Els almogàvers foren un grup de guerrers mercenaris que se singularitzava en el si dels exèrcits de la Corona d'Aragó. Esmentats per Jaume el Conqueridor i descrits per Desclot, són els protagonistes dels capítols en què Ramon Muntaner narra la seva màxima gesta: l'aventura en terres bizantines, a conseqüència de la qual els reis d'Aragó seran ducs d'Atenes i Neopàtria. Posteriorment el seu exemple serà al·legat en temps de dificultat Guerra de Successi, Guerra contra Napoleó fins que la Renaixença els reivindicarà i en farà un mite. El present article estudia com els tractà la literatura catalana, i també la castellana, des dels primers textos i sobretot durant els segles XIX i XX, en un recorregut en què es revela com un mite imperfecte, car els aspectes violents remarcats per la propaganda hel·lènica han estat un llast impossible d'eliminar.

Les creences populars entorn a l'aprenentatge d'una llengua estrangera (Anglès) abans dels vuit anys

L'avançament de l'edat d'aprenentatge obligatori d'una llengua estrangera deis 11 als 8 anys en el context educatiu espanyol, així com la demanda creixent per part deis pares d'introduir-ne l'ensenyament al més aviat possible, ja sigui al Primer Cicle de Primaria (6-7 anys) o encara més aviat, en l'Educació Infantil (3-5 anys), no solament indica un alt nivell de conscienciació de la necessitat de coneixement d'idiomes que el món actual exigeix, sinó que també evidencia la creença que existeix una edat privilegiada per aprendre llengües, que se situa en els primers anys de l'escolaritat.

PGC-1α induces mitochondrial and myokine transcriptional programs and lipid droplet and glycogen accumulation in cultured human skeletal muscle cells

The transcriptional coactivator peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) is a chief activator of mitochondrial and metabolic programs and protects against atrophy in skeletal muscle (skm). Here we tested whether PGC-1α overexpression could restructure the transcriptome and metabolism of primary cultured human skm cells, which display a phenotype that resembles the atrophic phenotype. An oligonucleotide microarray analysis was used to reveal the effects of PGC-1α on the whole transcriptome. Fifty-three different genes showed altered expression in response to PGC-1α: 42 upregulated and 11 downregulated. The main gene ontologies (GO) associated with the upregulated genes were mitochondrial components and processes and this was linked with an increase in COX activity, an indicator of mitochondrial content. Furthermore, PGC-1α enhanced mitochondrial oxidation of palmitate and lactate to CO2, but not glucose oxidation. The other most significantly associated GOs for the upregulated genes were chemotaxis and cytokine activity, and several cytokines, including IL-8/CXCL8, CXCL6, CCL5 and CCL8, were within the most highly induced genes. Indeed, PGC-1α highly increased IL-8 cell protein content. The most upregulated gene was PVALB, which is related to calcium signaling. Potential metabolic regulators of fatty acid and glucose storage were among mainly regulated genes. The mRNA and protein level of FITM1/FIT1, which enhances the formation of lipid droplets, was raised by PGC-1α, while in oleate-incubated cells PGC-1α increased the number of smaller lipid droplets and modestly triglyceride levels, compared to controls. CALM1, the calcium-modulated δ subunit of phosphorylase kinase, was downregulated by PGC-1α, while glycogen phosphorylase was inactivated and glycogen storage was increased by PGC-1α. In conclusion, of the metabolic transcriptome deficiencies of cultured skm cells, PGC-1α rescued the expression of genes encoding mitochondrial proteins and FITM1. Several myokine genes, including IL-8 and CCL5, which are known to be constitutively expressed in human skm cells, were induced by PGC-1α.

Foxm1 expression in prostate epithelial cells is essential for prostate carcinogenesis.

The treatment of advanced prostate cancer (PCa) remains a challenge. Identification of new molecular mechanisms that regulate PCa initiation and progression would provide targets for the development of new cancer treatments. The Foxm1 transcription factor is highly up-regulated in tumor cells, inflammatory cells, and cells of tumor microenvironment. However, its functions in different cell populations of PCa lesions are unknown. To determine the role of Foxm1 in tumor cells during PCa development, we generated two novel transgenic mouse models, one exhibiting Foxm1 gain-of-function and one exhibiting Foxm1 loss-of-function under control of the prostate epithelial-specific Probasin promoter. In the transgenic adenocarcinoma mouse prostate (TRAMP) model of PCa that uses SV40 large T antigen to induce PCa, loss of Foxm1 decreased tumor growth and metastasis. Decreased prostate tumorigenesis was associated with a decrease in tumor cell proliferation and the down-regulation of genes critical for cell proliferation and tumor metastasis, including Cdc25b, Cyclin B1, Plk-1, Lox, and Versican. In addition, tumor-associated angiogenesis was decreased, coinciding with reduced Vegf-A expression. The mRNA and protein levels of 11β-Hsd2, an enzyme playing an important role in tumor cell proliferation, were down-regulated in Foxm1-deficient PCa tumors in vivo and in Foxm1-depleted TRAMP C2 cells in vitro. Foxm1 bound to, and increased transcriptional activity of, the mouse 11β-Hsd2 promoter through the -892/-879 region, indicating that 11β-Hsd2 was a direct transcriptional target of Foxm1. Without TRAMP, overexpression of Foxm1 either alone or in combination with inhibition of a p19(ARF) tumor suppressor caused a robust epithelial hyperplasia, but was insufficient to induce progression from hyperplasia to PCa. Foxm1 expression in prostate epithelial cells is critical for prostate carcinogenesis, suggesting that inhibition of Foxm1 is a promising therapeutic approach for prostate cancer chemotherapy.

Sobre la molt primera tradició epigràfica valenciana

L'article analitza els primers autors (Pere Miquel Carbonell, Ermolao Barbaro, Jeroni Pau) i les primeres obres que citen inscripcions valencianes d'època romana. Tot seguit es posa en relació la informació present en aquestes obres amb la tradició de l'Antiquus i de l'Antiquissimus. Es conclou que el coneixement sobre l'epigrafia valenciana en el primer Renaixement entre els cercles humanístics italians i catalans és molt més ric i més antic del que tradicionalment es creia.

Peroxisome proliferator activated receptor BETA/DELTA as a central player in the skin response to ultra-violets radiation

Previous studies in the lab of Dr. Liliane Michalik, have shown thai the nuclear hormone receptor Peroxisome Proliferator Activated Receptor beta/delta (PPARß/ö) is an important regulator of skin homeostasis, being involved in the regulation of keratinocyte differentiation, inflammation, apoptosis, arid mouse skin wound healing. Studies of PPARß/ö knock out mice have suggested a possible role for this receptor in cancer. However, contradictory observations of the role for PPARß/ö on tumor growth have been published, depending on cellular contexts and biological models. Given the controversial role of PPARß/ö in skin carcinoma development, the main aim of this PhD work has been to further explore the implication of PPARß/ö in skin response to UV and skin tumor growth. This PhD dissertation is divided in four chapters. The first chapter describes the core part of the project, where I explored the changes in miRNA expression in the skin upon chronic UV irradiation of PPARß/ö wild type and knock-out mice. This analysis shed light on a miRNA- PPARß/ö signature and also predicted thai miR-21-3p (previously named miR-21*) is a key regulator of the PPARß/ö-dependent UV response in the pre-lesiona! skin. Using mice acutely UV-irradiated, ! further demonstrated that miR-21-3p is indirectly regulated by PPARß/ö through activation of Transforming Growth Factor (TGFß)-1 under UV exposure. I also show that miR-21-3p is deregulated in human cutaneous squamous celi carcinoma. In cultured keratinocytes, application of a miR-21 -3p mimic oligonucleotide sequence leads to the regulation of lipid metabolism-related pathway. In the second chapter, I demonstrate that the usage of an mRNA/miRNA combined bioinformatics analysis leads to the discovery of important pathways involved in the PPARß/ö-miRNA response of the skin to chronic UV irradiation, indeed, I validated angiogenesis and lipid metabolism as important functions regulated by PPARß/ö in this context. In the third chapter, we demonstrate that PPARß/5 knockout mice have decreased cutaneous squamous cell carcinomas incidence compared to wild type mice and that PPARß/5 directly activates the cSrc kinase gene. In the last chapter, we review novel insights into PPAR functions in keratinocytes and liver, with emphasis on PPARß/ö but also on PPARa. In summary, this PhD study shows that i) PPARß/5 is able to regulate biological function through regulation of miRNAs, and specifically through miR-21-3p, the passenger miRNA of the oncomiR miR-21, and that ii) the PPARß/5-dependent skin response to UV involves the regulation of angiogenesis and lipid metabolism. Furthermore, the bioinformatics study highlights the relevance of performing integrated mRNA and miRNA genome-wide studies in order to better screen mRNAs and/or miRNAs of interest in the biological context of diseases. - Des études préalables dans le laboratoire du Dr. Liliane Michalik ont démontré que le récepteur nucléaire PPARß/5 est un régulateur important de l'homéostasie de la peau, étant impliqué dans la régulation de la différenciation des keratinocytes, dans l'inflammation, dans l'apoptose et dans la cicatrisation de la peau chez !a souris. L'étude de souris knock-out pour le gène PPARß/5, ont suggérées un rôle possible de ce récepteur dans le cancer. Cependant, des observations opposées ont été publiées suggérant un rôle pro- ou anti- cancer selon le tissue impliqué et le type- cellulaire. En considérant cette controverse autour du rôle de PPARß/5 dans le développement des cancers de la peau, le but principal de mon projet de recherche aura été d'approfondir l'exploration du rôle de PPARß/5 dans la réponse de la peau aux UVs et dans le développement du cancer. Cette dissertation de thèse est divisée en quatre parties. Une première partie, représentant le coeur de mon travail de recherche, décrit la découverte de l'implication des microRNAs (rniRNAs) dans la réponse aux UVs de PPARß/ö et plus spécifiquement l'implication du miRNA miR- 21 -3p (précédemment nommé miR-21*). En étudiant un modèle de souris irradiées de manière aigüe aux UVs, nous montrons que ia régulation de miR-21-3p est PPARß/ö-däpenaante et que cette régulation à lieu par l'intermédiaire du facteur de transcription TGFß-1. Dans des cultures de keratinocytes Humains, la transfecticn d'une séquence oligonucléotidique similaire à celle de miR-21-3p (mimic), montre l'implication de rniR-21-3p dans des fonctions importantes pour le développement des cancers telles que le métabolisme des lipides. Dans un second chapitre, nous montrons que l'usage d'une méthode bioinformatique combinant l'expression des ARN messagers et des miRNAs permet de mettre en évidence des fonctions biologiques importantes lors de ia réponse de PPARß/ö à l'irradiation chronique. L'angiogenèse, le stress oxydatif et le métabolisme des lipides font partie de ces fonctions régulées par PPARß/5 dans la peau irradiée aux UVs. Nous mettons également en évidence la régulation du gène LpcatS par PPARß/5 dans la peau irradiée aux UV ainsi que dans des keratinocytes humains suggérant un rôle pour PPARß/5 dans le remodelage des lipides membranaires. Dans une troisième partie, nous établissons un lien entre la régulation de l'oncogène Src et l'activation de PPARß/5 dans les carcinomes spinocellulaires de la peau. Finalement dans un quatrième chapitre, nous faisons une revue des dernières recherches portées sur le rôle de PPARß/5 et de PPARa dans le foie et ia peau. En résumé ce projet de thèse représente un avancement pour la recherche sur rimplication de PPARß/5 dans la réponse aux UVs de la peau. Pour la première fois, un lien est établi entre ce facteur de transcription et la régulation de microRNAs dans le cadre du carcinome spinocellulare. Jusqu'alors resté dans l'ombre de rniR-21-5p, miR-21-3p est en fait fortement augmenté à la fois dans un modèle de souris d'irradiation aux UVs ainsi que dans ie carcinome spinocellulare chez i'humain. De nouvelles fonctions biologiques pour PPARß/5 ont été également mises en évidence dans ce travail, comme la régulation de l'angiogenèse ou du métabolisme des lipides dans Sa peau. De plus cette dissertation valorise l'intérêt d'une association entre le travail de laboratoire et celui de la bioinformatique.

Caracterização molecular da mosca-branca (Bemisia spp.) no Brasil

A análise de RAPD foi utilizada para avaliar a variabilidade genética de 12 populações brasileiras de Bemisia spp. (Hemiptera: Aleyrodidae). Foram analisados dez primers que permitiram a detecção de polimorfismo entre as amostras testadas. Os resultados obtidos mostraram que os indivíduos analisados provenientes de uma colônia mantida desde 1983 apresentaram perfis de RAPD próximos do padrão de B. tabaci oriunda da Califórnia, EUA. As outras populações analisadas apresentaram padrões semelhantes ao de B. tabaci raça B (=B. argentifolii), também oriunda da Califórnia, EUA, indicando a grande disseminação deste último biótipo no Brasil. A análise fenética dos dados dessas populações revelou uma alta homogeneidade entre os indivíduos do biótipo B de B. tabaci.

The G0/G1 switch gene 2 is a novel PPAR target gene.

PPARs (peroxisome-proliferator-activated receptors) alpha, beta/delta and gamma are a group of transcription factors that are involved in numerous processes, including lipid metabolism and adipogenesis. By comparing liver mRNAs of wild-type and PPARalpha-null mice using microarrays, a novel putative target gene of PPARalpha, G0S2 (G0/G1 switch gene 2), was identified. Hepatic expression of G0S2 was up-regulated by fasting and by the PPARalpha agonist Wy14643 in a PPARalpha-dependent manner. Surprisingly, the G0S2 mRNA level was highest in brown and white adipose tissue and was greatly up-regulated during mouse 3T3-L1 and human SGBS (Simpson-Golabi-Behmel syndrome) adipogenesis. Transactivation, gel shift and chromatin immunoprecipitation assays indicated that G0S2 is a direct PPARgamma and probable PPARalpha target gene with a functional PPRE (PPAR-responsive element) in its promoter. Up-regulation of G0S2 mRNA seemed to be specific for adipogenesis, and was not observed during osteogenesis or myogenesis. In 3T3-L1 fibroblasts, expression of G0S2 was associated with growth arrest, which is required for 3T3-L1 adipogenesis. Together, these data indicate that G0S2 is a novel target gene of PPARs that may be involved in adipocyte differentiation.

L’alguer de Posidonia oceanica de les illes Medes: més de trenta anys d’estudi

Fins on hem pogut esbrinar, el primer estudi publicat en una revista científica sobre la praderia o alguer de Posidonia oceanica de les illes Medes és el de De Haro (1965). En aquella època, la investigació delsfons marins estava als seus inicis i probablement la praderia de les illes Medes va ser un dels primers llocs en què, amb mitjans força precaris i a càrrec d’uns joves estudiants, es van efectuar prospeccions en immersió, tècnica que tot just començava però que molt ràpidament havia de substituir les dragues ialtres artefactes menys fiables. Amb el Programa de Bentos, entre 1972-1974 (Ros, 1982) –precisament aquest autor (vegeu el capítol 1) era un d’aquells «joves estudiants»; l’altre era en Jordi Camp, actualment investigador del CSIC–, la recerca bentònica va agafar un primer impuls i l’escafandre autònom es va incorporar plenament com a eina d’observació i mostreig. Durant aquest programa, es va situar una de les estacions de treball a les illes Medes, i l’alguer de Posidonia va ser un dels hàbitats objecte d’estudi, tot i que més aviat amb un objectiu faunístic i biocenòtic que estrictament ecològic.

A downstream mediator in the growth repression limb of the jasmonate pathway.

Wounding plant tissues initiates large-scale changes in transcription coupled to growth arrest, allowing resource diversion for defense. These processes are mediated in large part by the potent lipid regulator jasmonic acid (JA). Genes selected from a list of wound-inducible transcripts regulated by the jasmonate pathway were overexpressed in Arabidopsis thaliana, and the transgenic plants were then assayed for sensitivity to methyl jasmonate (MeJA). When grown in the presence of MeJA, the roots of plants overexpressing a gene of unknown function were longer than those of wild-type plants. When transcript levels for this gene, which we named JASMONATE-ASSOCIATED1 (JAS1), were reduced by RNA interference, the plants showed increased sensitivity to MeJA and growth was inhibited. These gain- and loss-of-function assays suggest that this gene acts as a repressor of JA-inhibited growth. An alternative transcript from the gene encoding a second protein isoform with a longer C terminus failed to repress jasmonate sensitivity. This identified a conserved C-terminal sequence in JAS1 and related genes, all of which also contain Zim motifs and many of which are jasmonate-regulated. Both forms of JAS1 were found to localize to the nucleus in transient expression assays. Physiological tests of growth responses after wounding were consistent with the fact that JAS1 is a repressor of JA-regulated growth retardation.

A new perspective on the evolutionary history of western European Sorex araneus group revealed by paternal and maternal molecular markers.

The species of the common shrew (Sorex araneus) group are morphologically very similar, but have undergone a spectacular chromosomal evolution. We investigate here the evolutionary history of the Sorex araneus group distributed in western Europe. In particular, we clarify the position of a difficult species, S. granarius, using sex-specific (mtDNA and Y-chromosome) markers. The karyotype of S. granarius is generally considered similar to the common ancestor of the restricted group considered here. The mtDNA data (1.4 kb) confirms the close relationship between S. granarius and S. araneus sensu stricto (hereafter S. araneus s.s.), but the Y-chromosome (3.4 kb) produces a quite different picture: S. granarius is closely related to another species, S. coronatus. Comparison of mtDNA and Y-chromosome phylogenies suggests that the genetic and chromosomal evolution in this group are disconnected processes. The evolutionary history of the south-western European populations of the S. araneus group can only be understood considering secondary contacts between taxa after their divergence, implying genetic exchanges by means of hybridization and/or introgression.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Detecção de fungos micorrízicos arbusculares em raízes de cafeeiro e de crotalária cultivada na entrelinha

Avaliou-se a ocorrência de fungos micorrízicos arbusculares (FMAs) no solo rizosférico e nas raízes de cafeeiro (Coffea arabica L.) e de Crotalaria breviflora DC., cultivada na entrelinha como adubo verde. Amostras de solo rizosférico e raízes foram coletadas em julho de 1997, em parte de um experimento de longa duração conduzido no campo pelo Instituto Agronômico do Paraná, no município de Mirasselva, PR. Determinou-se a diversidade de FMAs, por meio da identificação morfológica dos esporos, a freqüência de ocorrência de populações de FMAs por meio da contagem direta de esporos no solo, e a colonização radicular. Extraiu-se DNA de raízes de cafeeiro colonizadas e não-colonizadas e de esporos de Acaulospora longula e Scutellospora gilmorei, coletados na rizosfera, realizando-se a PCR ("Polimerase chain reaction") com primers ITS ("Internal transcribed spacer") e comparando os perfis de bandas obtidos. O cultivo de crotalária na entrelinha do cafeeiro aumentou a concentração de esporos de FMAs na rizosfera do cafeeiro. A crotalária e o cafeeiro estimularam populações diferentes de FMAs. O gênero Acaulospora predominou na rizosfera do cafeeiro, e Scutellospora e Gigaspora na rizosfera da crotalária. Usando técnicas moleculares, foi possível caracterizar FMAs na rizosfera e nas raízes colonizadas do cafeeiro. O fungo micorrízico Scutellospora gilmorei, de ocorrência comum em cafeeiro e crotalária, não foi encontrado colonizando as raízes do cafeeiro. O uso de técnicas moleculares pode auxiliar no estudo da dinâmica populacional de FMAs no campo.

Extreme homogeneity among Brazilian wheat genotypes determined by RAPD markers

Random amplified polymorphic DNA markers (RAPD) were used to estimate the variability of 14 genotypes of Brazilian wheat (Triticum aestivum L.), using a set of 50 random 10mer primers. A total of 256 reproducibly scorable DNA amplification products were obtained from 48 of the primers, 83% of which were polymorphic. Genetic distances among genotypes were calculated and a dendrogram and a principal coordinates analysis showing the genetic relationships among them were obtained. Despite the low variability found (average genetic distance of 27%), two groups of genotypes could be identified, which probably reflect how they were formed. Studies such as this one may be important in the planning and development of future improvement programs for this plant species.

Tumor-host interactions Part 1: Stromal signatures of breast and prostate cancer Part 2: GLG1 and the control of the secretory pathway in tumor cells

Tumor-host interaction is a key determinant during cancer progression, from primary tumor growth to metastatic dissemination. At each step, tumor cells have to adapt to and subvert different types of microenvironment, leading to major phenotypic and genotypic alterations that affect both tumor and surrounding stromal compartments. Understanding the molecular mechanisms that govern tumor-host interplay may be essential for better comprehension of tumorigenesis in an effort to improve current anti-cancer therapies. The present work is composed of two projects that address tumor-host interactions from two different perspectives, the first focusing on the characterization of tumor-associated stroma and the second on membrane trafficking in tumor cells. Part 1. To selectively address stromal gene expression changes during cancer progression, oligonucleotide-based Affymetrix microarray technology was used to analyze the transcriptomes of laser-microdissected stromal cells derived from invasive human breast and prostate carcinoma. Comparison showed that invasive breast and prostate cancer elicit distinct, tumor-specific stromal responses, with a limited panel of shared induced and/or repressed genes. Both breast and prostate tumor-specific deregulated stromal gene sets displayed statistically significant survival-predictive ability for their respective tumor type. By contrast, a stromal gene signature common to both tumor types did not display prognostic value, although expression of two individual genes within this common signature was found to be associated with patient survival. Part 2. GLG1 is known as an E-selectin ligand and an intracellular FGF receptor, depending on cell type and context. Immunohistochemical and immunofluorescence analyses showed that GLG1 is primarily localized in the Golgi of human tumor cells, a central location in the biosynthetic/secretory pathways. GLG1 has been shown to interact with and to recruit the ARF GEF BIGI to the Golgi membrane. Depletion of GLG1 or BIGI markedly reduced ARF3 membrane localization and activation, and altered the Golgi structure. Interestingly, these perturbations did not impair constitutive secretion in general, but rather seemed to impair secretion of a specific subset of proteins that includes MMP-9. Thus, GLG1 coordinates ARF3 activation by recruiting BIGI to the Golgi membrane, thereby affecting secretion of specific molecules. - Les interactions tumeur-hôte constituent un élément essentiel à la progression tumorale, de la croissance de la tumeur primaire à la dissémination des métastases. A chaque étape, les cellules tumorales doivent s'adapter à différents types de microenvironnement et les détourner à leur propre avantage, donnant lieu à des altérations phénotypiques et génotypiques majeures qui affectent aussi bien la tumeur elle-même que le compartiment stromal environnant. L'étude des mécanismes moléculaires qui régissent les interactions tumeur-hôte constitue une étape essentielle pour une meilleure compréhension du processus de tumorigenèse dans le but d'améliorer les thérapies anti cancer existantes. Le travail présenté ici est composé de deux projets qui abordent la problématique des interactions tumeur-hôte selon différentes perspectives, le premier se concentrant sur la caractérisation du stroma tumoral et le second sur le trafic intracellulaire des cellules tumorales. Partie 1. Pour examiner les changements d'expression des gènes dans le stroma en réponse à la progression du cancer, des puces à ADN Affymetrix ont été utilisées afin d'analyser les transcriptomes des cellules stromales issues de carcinomes invasifs du sein et de la prostate et collectées par microdissection au laser. L'analyse comparative a montré que les cancers invasifs du sein et de la prostate provoquent des réponses stromales spécifiques à chaque type de tumeur, et présentent peu de gènes induits ou réprimés de façon similaire. L'ensemble des gènes dérégulés dans le stroma associé au cancer du sein, ou à celui de la prostate, présente une valeur pronostique pour les patients atteints d'un cancer du sein, respectivement de la prostate. En revanche, la signature stromale commune aux deux types de cancer n'a aucune valeur prédictive, malgré le fait que l'expression de deux gènes présents dans cette liste soit liée à la survie des patients. Partie 2. GLG1 est connu comme un ligand des sélectines E ainsi que comme récepteur intracellulaire pour des facteurs de croissances FGFs selon le type de cellule dans lequel il est exprimé. Des analyses immunohistochimiques et d'immunofluorescence ont montré que dans les cellules tumorales, GLG1 est principalement localisé au niveau de l'appareil de Golgi, une place centrale dans la voie biosynthétique et sécrétoire. Nous avons montré que GLG1 interagit avec la protéine BIGI et participe à son recrutement à la membrane du Golgi. L'absence de GLG1 ou de BIGI réduit drastiquement le pool d'ARF3 associé aux membranes ainsi que la quantité d'ARF3 activés, et modifie la structure de l'appareil de Golgi. Il est particulièrement intéressant de constater que ces perturbations n'ont pas d'effet sur la sécrétion constitutive en général, mais semblent plutôt affecter la sécrétion spécifique d'un sous-groupe défini de protéines comprenant MMP-9. GLG1 coordonne donc l'activation de ARF3 en recrutant BIGI à la membrane du Golgi, agissant par ce moyen sur la sécrétion de molécules spécifiques.