938 resultados para Non-host resistance


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human land use tends to decrease the diversity of native plant species and facilitate the invasion and establishment of exotic ones. Such changes in land use and plant community composition usually have negative impacts on the assemblages of native herbivorous insects. Highly specialized herbivores are expected to be especially sensitive to land use intensification and the presence of exotic plant species because they are neither capable of consuming alternative plant species of the native flora nor exotic plant species. Therefore, higher levels of land use intensity might reduce the proportion of highly specialized herbivores, which ultimately would lead to changes in the specialization of interactions in plant-herbivore networks. This study investigates the community-wide effects of land use intensity on the degree of specialization of 72 plant-herbivore networks, including effects mediated by the increase in the proportion of exotic plant species. Contrary to our expectation, the net effect of land use intensity on network specialization was positive. However, this positive effect of land use intensity was partially canceled by an opposite effect of the proportion of exotic plant species on network specialization. When we analyzed networks composed exclusively of endophagous herbivores separately from those composed exclusively of exophagous herbivores, we found that only endophages showed a consistent change in network specialization at higher land use levels. Altogether, these results indicate that land use intensity is an important ecological driver of network specialization, by way of reducing the local host range of herbivore guilds with highly specialized feeding habits. However, because the effect of land use intensity is offset by an opposite effect owing to the proportion of exotic host species, the net effect of land use in a given herbivore assemblage will likely depend on the extent of the replacement of native host species with exotic ones.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Obesity is increasing worldwide and is triggered, at least in part, by enhanced caloric intake. Food intake is regulated by a complex mechanism involving the hypothalamus and hindbrain circuitries. However, evidences have showing that reward systems are also important in regulating feeding behavior. In this context, amygdala is considered a key extra-hypothalamic area regulating feeding behavior in human beings and rodents. This review focuses on the regulation of food intake by amygdala and the mechanisms of insulin resistance in this brain area. Similar to the hypothalamus the anorexigenic effect of insulin is mediated via PI3K (phosphoinositide 3-kinase)/Akt (protein kinase B) pathway in the amygdala. Insulin decreases NPY (neuropeptide Y) and increases oxytocin mRNA levels in the amygdala. High fat diet and saturated fatty acids induce inflammation, ER (endoplasmic reticulum) stress and the activation of serine kinases such as PKCθ (protein kinase C theta), JNK (c-Jun N-terminal kinase) and IKKβ (inhibitor of nuclear factor kappa-B kinase beta) in the amygdala, which have an important role in insulin resistance in this brain region. Overexpressed PKCθ in the CeA (central nucleus of amygdala) of rats increases weight gain, food intake, insulin resistance and hepatic triglycerides content. The inhibition of ER stress ameliorates insulin action/signaling, increases oxytocin and decreases NPY gene expression in the amygdala of high fat feeding rodents. Those data suggest that PKCθ and ER stress are main mechanisms of insulin resistance in the amygdala of obese rats and play an important role regulating feeding behavior.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We perform variational studies of the interaction-localization problem to describe the interaction-induced renormalizations of the effective (screened) random potential seen by quasiparticles. Here we present results of careful finite-size scaling studies for the conductance of disordered Hubbard chains at half-filling and zero temperature. While our results indicate that quasiparticle wave functions remain exponentially localized even in the presence of moderate to strong repulsive interactions, we show that interactions produce a strong decrease of the characteristic conductance scale g^{*} signaling the crossover to strong localization. This effect, which cannot be captured by a simple renormalization of the disorder strength, instead reflects a peculiar non-Gaussian form of the spatial correlations of the screened disordered potential, a hitherto neglected mechanism to dramatically reduce the impact of Anderson localization (interference) effects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The syndrome of resistance to thyroid hormone (RTH β) is an inherited disorder characterized by variable tissue hyposensitivity to 3,5,30-l-triiodothyronine (T3), with persistent elevation of free-circulating T3 (FT3) and free thyroxine (FT4) levels in association with nonsuppressed serum thyrotropin (TSH). Clinical presentation is variable and the molecular analysis of THRB gene provides a short cut diagnosis. Here, we describe 2 cases in which RTH β was suspected on the basis of laboratory findings. The diagnosis was confirmed by direct THRB sequencing that revealed 2 novel mutations: the heterozygous p.Ala317Ser in subject 1 and the heterozygous p.Arg438Pro in subject 2. Both mutations were shown to be deleterious by SIFT, PolyPhen, and Align GV-GD predictive methods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polycystic ovary syndrome (PCOS) has been associated with an autoimmune origin, either per se or favoring the onset of autoimmune diseases, from a stimulatory action on the inflammatory response. Thus, autoimmune thyroiditis (AIT) could be more prevalent among women with PCOS. To evaluate the prevalence of AIT in women with PCOS. It was a cross-sectional study, in a tertiary center, including 65 women with PCOS and 65 women without this condition. Clinical and laboratory parameters were evaluated and a thyroid ultrasound scan was performed. Levels of thyroid-stimulating hormone (TSH), free thyroxine (FT4), free triiodothyronine (FT3), anti-thyroid peroxidase (anti-TPO) antibodies, anti-thyroglobulin (anti-TG) antibodies, and thyroid ultrasound findings were evaluated. The prevalence of subclinical hypothyroidism (SCH) in women with PCOS was 16.9% and 6.2% in the non-PCOS group. AIT was more common in the PCOS group compared with the non-PCOS group (43.1% versus 26.2%). But, when it was adjusted by weight and insulin resistance, the difference in the thyroiditis risk was not observed (OR 0.78, CI 0.28-2.16). AIT risk was similar in the PCOS and the non-PCOS group. SCH are more common in women with PCOS, highlighting a need for periodic monitoring of thyroid function.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Obesity is a major risk factor for asthma. Likewise, obesity is known to increase disease severity in asthmatic subjects and also to impair the efficacy of first-line treatment medications for asthma, worsening asthma control in obese patients. This concept is in agreement with the current understanding that some asthma phenotypes are not accompanied by detectable inflammation, and may not be ameliorated by classical anti-inflammatory therapy. There are growing evidences suggesting that the obesity-related asthma phenotype does not necessarily involve the classical T(H)2-dependent inflammatory process. Hormones involved in glucose homeostasis and in the pathogeneses of obesity likely directly or indirectly link obesity and asthma through inflammatory and non-inflammatory pathways. Furthermore, the endocrine regulation of the airway-related pre-ganglionic nerves likely contributes to airway hyperreactivity (AHR) in obese states. In this review, we focused our efforts on understanding the mechanism underlying obesity-related asthma by exploring the T(H)2-independent mechanisms leading to this disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this research was to study the effect of chemical additives (lime and Portland cement) associated with sodium silicate on soil in order to obtain compressed soil bricks. Mini panels were constructed with such bricks being their physical and mechanical characteristics determined in laboratory conditions and their behavior evaluated through the association of destructive and non-destructive methods. For this purpose a sandy soil and a finely divided one were added to Portland cement and lime in the dosage of 6% and 10% taken in dry weight basis in relation to the dry soil. The sodium silicate dosage of 4% was also taken in dry weight basis in relation to the dry soil-cement or to the dry soil-lime. The compressed soil bricks were cured in a humidity chamber for 7; 28; 56 and 91 days. The bricks were laid on the fourteenth day to form prismatic mini panels each one with four layers of bricks. After 28; 56 and 91 days the mini panels were submitted to both; ultrasonic and compressive tests to determine its elastic properties (dynamic modulus) and the compressive resistance. The best results in terms of compressive strength, water absorption capacity or dynamic elastic modulus, were reached by the sandy soil added to 10% of Portland cement or lime associated with sodium silicate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.