Distribution of major, minor, and trace metals in lake environments of Antarctica

The concentrations of major, minor and trace metals were measured in water samples collected from five shallow Antarctic lakes (Carezza, Edmonson Point (No 14 and 15a), Inexpressible Island and Tarn Flat) found in Terra Nova Bay (northern Victoria Land, Antarctica) during the Italian Expeditions of 1993-2001. The total concentrations of a large suite of elements (Al, As, Ba, Ca, Cd, Ce, Co, Cr, Cs, Cu, Fe, Ga, Gd, K, La, Li, Mg, Mn, Mo, Na, Nd, Ni, Pb, Pr, Rb, Sc, Si, Sr, Ta, Ti, U, V, Y, W, Zn and Zr) were determined using spectroscopic techniques (ICP-AES, GF-AAS and ICP-MS). The results are similar to those obtained for the freshwater lakes of the Larsemann Hills, East Antarctica, and for the McMurdo Dry Valleys. Principal Component Analysis (PCA) and Cluster Analysis (CA) were performed to identify groups of samples with similar characteristics and to find correlations between the variables. The variability observed within the water samples is closely connected to the sea spray input; hence, it is primarily a consequence of geographical and meteorological factors, such as distance from the ocean and time of year. The trace element levels, in particular those of heavy metals, are very low, suggesting an origin from natural sources rather than from anthropogenic contamination.

Medication prescribing and administration in nursing homes

Objective: to examine the key determinants of pharmaco-epidemiology in Australian nursing homes. Design: a cross-sectional survey of medication use in 998 residents in 15 nursing homes in Southern Queensland and Northern New South Wales, Results: the total, laxative, digoxin/diuretic, benzodiazepine and psycholeptic medication prescribed and administered to residents of nursing homes was affected to differing extents by age and gender, the nursing home, resident functional disability and medical practitioner. Resident Classification Instrument (RCI) category and nursing home were the dominant determinants for prescribing and administration of the total drugs, laxative, benzodiazepine and psycholeptic medications. In contrast, the resident use of digoxin and/or diuretics was dependent on the resident age and on the functional disability (RCI category) of the resident but not medical practitioner or nursing home. Approximately 30% of medications were prescribed on a pro re nata (p.r.n.) basis and administered at the discretion of registered nurses. Conclusion: nursing home culture is a major determinant of the variability in medication use between residents, particularly for those medications often prescribed for p.r.n. use. The nursing home does not account for variation in the use of digoxin and/or diuretics which are prescribed on a non-discretionary basis.

Tension regulation during lengthening and shortening actions of the human soleus muscle

In the present study we investigated tension regulation in the human soleus (SOL) muscle during controlled lengthening and shortening actions. Eleven subjects performed plantar flexor efforts on an ankle torque motor through 30 degrees of ankle displacement (75 degrees-105 degrees internal ankle angle) at lengthening and shortening velocities of 5, 15 and 30 degrees s(-1). To isolate the SOL from the remainder of the triceps surae, the subject's knee was flexed to 60 degrees during all trials. Voluntary plantar flexor efforts were performed under two test conditions: (1) maximal voluntary activation (MVA) of the SOL, and (2) constant submaximal voluntary activation (SVA) of the SOL. SVA trials were performed with direct visual feedback of the SOL electromyogram (EMG) at a level resulting in a torque output of 30% of isometric maximum. Angle-specific (90 degrees ankle angle) torque and EMG of the SOL, medial gastrocnemius (MG) and tibialis anterior (TA) were recorded. In seven subjects from the initial group, the test protocol was repeated under submaximal percutaneous electrical activation (SEA) of SOL (to 30% isometric maximal effort). Lengthening torques were significantly greater than shortening torques in all test conditions. Lengthening torques in MVA and SVA were independent of velocity and remained at the isometric level, whereas SEA torques were greater than isometric torques and increased at higher lengthening velocities. Shortening torques were lower than the isometric level for all conditions. However, whereas SVA and SEA torques decreased at higher velocities of shortening, MVA torques were independent of velocity. These results indicate velocity- and activation-type-specific tension regulation in the human SOL muscle.

Er(3+) doped phosphoniobate glasses and planar waveguides: structural and optical properties

Phosphoniobate glasses with composition (mol%) (100-x) NaPO(3)-xNb(2)O(5) ( x varying from 11 to 33) were prepared and characterized by means of thermal analysis, Fourier transform infrared spectroscopy, Raman scattering and (31)P nuclear magnetic resonance. The addition of Nb(2)O(5) to the polyphosphate base glass leads to depolymerization of the metaphosphate structure. Different colors were observed and assigned as indicating the presence of Nb(4+) ions, as confirmed by electron paramagnetic resonance measurements. The color was observed to depend on the glass composition and melting temperature as well. Er(3+) containing samples were also prepared. Strong emission in the 1550 nm region was observed. The Er(3+4)I(15/2) emission quantum efficiency was observed to be 90% and the quenching concentration was observed to be 1.1 mol%( 1.45 x 10(20) ions cm(-3)). Planar waveguides were prepared by Na(+)-K(+)-Ag(+) ion exchange with Er(3+) containing samples. Optical parameters of the waveguides were measured at 632.8, 543.5 and 1550 nm by the prism coupling technique as a function of the ion exchange time and Ag(+) concentration. The optimized planar waveguides show a diffusion depth of 5.9 mu m and one propagating mode at 1550 nm.

Brood production increases when artificial heating is provided to colonies of stingless bees

Although stingless bees are capable of maintaining their nest temperature within certain limits, brood production of several species declines or even completely stops during periods of low ambient temperature. In the present study, we investigated whether the brood production of the meliponine species Nannotrigona testaceicornis can be artificially increased through heating the colonies during the cold season. For this, we monitored the rate of brood cell production of seven hives in intervals of 24 hours under two different experimental conditions: 1. without; and 2. with heating. Each treatment (first with and subsequently without heating) lasted for nine consecutive days. The ambient temperature (TA) during both experimental periods was very similar (TA(WITH) = 16.1 degrees C; TA(WITHOUT) = 16.3 degrees C). On average, the colonies built 3.6 brood cells per day without and 15.8 brood cells per day with artificial heating (Wilcoxon Rank Sum test: T = 10, Z = 4, P < 0.001). In both treatments, the rate of brood cell production increased with increasing environmental temperature (Spearman Rank Correlation: R(WITH) = 0.71, P = 0.02; R(WITHOUT) = 0.66, P = 0.05). We concluded that artificial heating during cold periods increased the brood cell production in N. testaceicornis Our results indicate that the use of heaters for stingless bee hives during periods of low ambient temperature may be helpful for stingless beekeeping.

Identification of novel non-autonomous CemaT transposable elements and evidence of their mobility within the C. elegans genome

We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.

EULAR/PRINTO/PRES criteria for Henoch-Schonlein purpura, childhood polyarteritis nodosa, childhood Wegener granulomatosis and childhood Takayasu arteritis: Ankara 2008. Part II: Final classification criteria

Objectives To validate the previously proposed classification criteria for Henoch-Schonlein purpura (HSP), childhood polyarteritis nodosa (c-PAN), c-Wegener granulomatosis (c-WG) and c-Takayasu arteritis (c-TA). Methods Step 1: retrospective/prospective webdata collection for children with HSP, c-PAN, c-WG and c-TA with age at diagnosis <= 18 years. Step 2: blinded classification by consensus panel of a representative sample of 280 cases. Step 3: statistical (sensitivity, specificity, area under the curve and.-agreement) and nominal group technique consensus evaluations. Results 827 patients with HSP, 150 with c-PAN, 60 with c-WG, 87 with c-TA and 52 with c-other were compared with each other. A patient was classified as HSP in the presence of purpura or petechiae (mandatory) with lower limb predominance plus one of four criteria: (1) abdominal pain; (2) histopathology (IgA); (3) arthritis or arthralgia; (4) renal involvement. Classification of c-PAN required a systemic inflammatory disease with evidence of necrotising vasculitis OR angiographic abnormalities of medium-/small-sized arteries (mandatory criterion) plus one of five criteria: (1) skin involvement; (2) myalgia/muscle tenderness; (3) hypertension; (4) peripheral neuropathy; (5) renal involvement. Classification of c-WG required three of six criteria: (1) histopathological evidence of granulomatous inflammation; (2) upper airway involvement; (3) laryngo-tracheo-bronchial involvement; (4) pulmonary involvement (x-ray/CT); (5) antineutrophilic cytoplasmic antibody positivity; (6) renal involvement. Classification of c-TA required typical angiographic abnormalities of the aorta or its main branches and pulmonary arteries (mandatory criterion) plus one of five criteria: (1) pulse deficit or claudication; (2) blood pressure discrepancy in any limb; (3) bruits; (4) hypertension; (5) elevated acute phase reactant. Conclusion European League Against Rheumatism/Paediatric Rheumatology International Trials Organisation/Paediatric Rheumatology European Society propose validated classification criteria for HSP, c-PAN, c-WG and c-TA with high sensitivity/specificity.

Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event

Background:. Although the role of the lung alveolar macrophage (AM) as a mediator of acute lung injury (ALI) after lung ischemia/reperfusion (I/R) has been suggested by animal experiments, it has not been determined whether AMs mediate ALI after intestinal I/R. The objective of this study was to determine the effect of AM elimination on ALI after intestinal I/R in rats. Mwthods: Male Wistar rats (n = 90) were randomly divided into three groups: the clodronate-liposomes (CLOD-LIP) group received intratracheal treatment with CLOD-LIP; the liposomes (LIP) group received intratracheal treatment with LIP; and the nontreated (UNTREAT) group received no treatment. Twenty-four hours later each group was randomly divided into three subgroups: the intestinal I/R subgroup was subjected to 45-minute intestinal ischemia and 2-hour reperfusion; the laparotomy (LAP) subgroup was subjected to LAP and sham procedures; the control (CTR) subgroup received no treatment. At the end of reperfusion, ALI was quantitated in all the animals by the Evans blue dye (EBD) method. Results: ALI values are expressed as EBD lung leakage (mu g EBD/g dry lung weight). EBD lung leakage values in the CLOD-LIP group were 32.59 +/- 12.74 for I/R, 27.74 +/- 7.99 for LAP, and 33.52 +/- 10.17 for CTR. In the LIP group, lung leakage values were 58.02 +/- 18.04 for I/R, 31.90 +/- 8.72 for LAP, and 27.17 +/- 11.48 for CTR. In the UNTREAT group, lung leakage values were 55.60 +/- 10.96 for I/R, 35.99 +/- 6.89 for LAP, and 30.83 +/- 8.41 for CTR. Within each group, LAP values did not differ from CTR values. However, in the LIP and UNTREAT groups, values for both the LAP and CTR subgroups were lower than values for the I/R subgroup (p < 0.001). The CLOD-LIP I/R subgroup value was less (p < 0.001) than the I/R subgroup values in the LIP and UNTREAT groups. These results indicated that I/R provokes ALI that can be prevented by CLOD-LIP treatment, and further suggested that AMs are essential for ALI occurrence induced by intestinal I/R in rats.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Potassium in Hemorrhagic Shock: A Potential Marker of Tissue Hypoxia

Background: This study was designed to evaluate serum potassium level variation in a porcine model of hemorrhagic shock ( HS). Methods: Eight pigs were studied in a controlled hemorrhage model of HS. Blood withdrawal began at a 50 mL/min to 70 mL/min rate, adjusted to reach a mean arterial pressure ( MAP) level of 60 mm Hg in 10 minutes. When MAP reached 60 mm Hg, the blood withdrawal rate was adjusted to maintain a MAP decrease rate of 10 mm Hg every 2 minutes to 4 minutes. Arterial and mixed venous blood samples were collected at MAP levels of 60 mm Hg, 50 mm Hg, 40 mm Hg, 30 mm Hg, 20 mm Hg, and 10 mm Hg and analyzed for oxygen saturation, PO(2), PCO(2), potassium, lactate, bicarbonate, hemoglobin, pH, and standard base excess. Results: Significant increase in serum potassium occurred early in all animals. The rate of rise in serum potassium and its levels accompanied the hemodynamic deterioration. Hyperkalemia ( K >5 mmol/L) incidence was 12.5% at 60 mm Hg and 50 mm Hg, 62.5% at 40 mm Hg, 87.5% at 30 mm Hg, and 100% at 20 mm Hg. Strong correlations were found between potassium levels and lactate ( R = 0.82), SvO(2) ( R = 0.87), Delta pH ( R = 0.83), and Delta PCO(2) ( R = 0.82). Conclusions: Serum potassium increase accompanies the onset of HS. The rise in serum potassium was directly related to the hemodynamic deterioration of HS and strongly correlated with markers of tissue hypoxia.

Fluid Resuscitation With Isotonic or Hypertonic Saline Solution Avoids Intraneural Calcium Influx After Traumatic Brain Injury Associated With Hemorrhagic Shock

Background: Calcium is one of the triggers involved in ischemic neuronal death. Because hypotension is a strong predictor of outcome in traumatic brain injury (TBI), we tested the hypothesis that early fluid resuscitation blunts calcium influx in hemorrhagic shock associated to TBI. Methods: Fifteen ketamine-halothane anesthetized mongrel dogs (18.7 kg +/- 1.4 kg) underwent unilateral cryogenic brain injury. Blood was shed in 5 minutes to a target mean arterial pressure of 40 mm Hg to 45 mm Hg and maintained at these levels for 20 minutes (shed blood volume = 26 mL/kg +/- 7 mL/kg). Animals were then randomized into three groups: CT (controls, no fluid resuscitation), HS (7.5% NaCl, 4 mL/kg, in 5 minutes), and LR (lactate Ringer`s, 33 mL/kg, in 15 minutes). Twenty minutes later, a craniotomy was performed and cerebral biopsies were obtained next to the lesion (""clinical penumbra"") and from the corresponding contralateral side (""lesion`s mirror"") to determine intracellular calcium by fluorescence signals of Fura-2-loaded cells. Results: Controls remained hypotensive and in a low-flow state, whereas fluid resuscitation improved hemodynamic profile. There was a significant increase in intracellular calcium in the injured hemisphere in CT (1035 nM +/- 782 nM), compared with both HS (457 nM +/- 149 nM, p = 0.028) and LR (392 nM +/- 178 nM, p = 0.017), with no differences between HS and LR (p = 0.38). Intracellular calcium at the contralateral, uninjured hemisphere was 438 nM +/- 192 nM in CT, 510 nM +/- 196 nM in HS, and 311 nM +/- 51 nM in LR, with no significant differences between them. Conclusion: Both small volume hypertonic saline and large volume lactated Ringer`s blunts calcium influx in early stages of TBI associated to hemorrhagic shock. No fluid resuscitation strategy promotes calcium influx and further neural damage.

A Comparison Between Pulse Pressure Variation and Right End Diastolic Volume Index as Guides to Resuscitation in a Model of Hemorrhagic Shock in Pigs

Background: Different hemodynamic parameters including static indicators of cardiac preload as right ventricular end-diastolic volume index (RVEDVI) and dynamic parameters as pulse pressure variation (PPV) have been used in the decision-making process regarding volume expansion in critically ill patients. The objective of this study was to compare fluid resuscitation guided by either PPV or RVEDVI after experimentally induced hemorrhagic shock. Methods: Twenty-six anesthetized and mechanically ventilated pigs were allocated into control (group I), PPV (group II), or RVEDVI (group III) group. Hemorrhagic shock was induced by blood withdrawal to target mean arterial pressure of 40 mm Hg, maintained for 60 minutes. Parameters were measured at baseline, time of shock, 60 minutes after shock, immediately after resuscitation with hydroxyethyl starch 6% (130/0.4), 1 hour and 2 hours thereafter. The endpoint of fluid resuscitation was determined as the baseline values of PPV and RVEDVI. Statistical analysis of data was based on analysis of variance for repeated measures followed by the Bonferroni test (p < 0.05). Results: Volume and time to resuscitation were higher in group III than in group II (group III = 1,305 +/- 331 mL and group II = 965 +/- 245 mL, p < 0.05; and group III = 24.8 +/- 4.7 minutes and group II = 8.8 +/- 1.3 minutes, p < 0.05, respectively). All static and dynamic parameters and biomarkers of tissue oxygenation were affected by hemorrhagic shock and nearly all parameters were restored after resuscitation in both groups. Conclusion: In the proposed model of hemorrhagic shock, resuscitation to the established endpoints was achieved within a smaller amount of time and with less volume when guided by PPV than when guided by pulmonary artery catheter-derived RVEDVI.

Standard Examination System for Laparoscopy in Penetrating Abdominal Trauma

Background: The high missed occult small bowel injuries (SBI) associated with laparoscopy in trauma (LIT) is a major reason why some surgeons still preclude LIT today. No standardized laparoscopic examination for evaluation of the peritoneal cavity is described for trauma. The objective of this article is to verify if a systematic standardized laparoscopic approach could correctly identify SBI in the peritoneal cavity for penetrating abdominal trauma (PAT). Methods: Victims with PAT were evaluated in a prospective, nonrandomized study. A total of 75 hemodynamically stable patients with suspected abdominal injuries were operated by LIT and converted to laparotomy if criteria were met: SBI and lesions to blind spot zones-retroperitoneal hematoma, injuries to segments VI or VII of the liver, or injuries to the posterior area of the spleen. Inclusion criteria were equivocal evidence of abdominal injuries or peritonea] penetration; systolic blood pressure >90 mm Hg and <3 L of IV fluids in the first hour of admission; Glasgow Coma Scale score >12; and age >12 years. Exclusion criteria were back injuries; pregnancy; previous laparotomy; and chronic cardiorespiratory disease. Results: Sixty patients were males and there were 38 stab wounds and 37 gunshot wounds. No SBI was missed, but a pancreatic lesion was undiagnosed due to a retroperitoneal hematoma. Twenty patients (26.6%) were converted. Unnecessary laparotomies were avoided in 73.33%. Therapeutic LIT was possible in 22.7%. Accuracy was 98.66% with 97.61% sensitivity and 100% specificity. Conclusions: Standard systematic laparoscopic exploration was 100% effective to detect SBI in the peritoneal cavity. Conversion from LIT to laparotomy should be done if injuries to blind spot zones are found which are poorly evaluated by LIT. Therapeutic LIT is feasible in PAT.

Low Hematocrit Levels Increase Intracranial Pressure in an Animal Model of Cryogenic Brain Injury

Background: Brain injury is responsible for significant morbidity and mortality in trauma patients, but controversy still exists over optimal fluid management for these patients. This study aimed to investigate the effects of acute hemodilution with hydroxyethyl starch (HES) or lactated Ringer`s solution (LR) in intracranial pressure (ICP) and cerebral perfusion pressure (CPP) in dogs submitted to a cryogenic brain injury model. Methods: Design-Prospective laboratory animal study. Setting-Research laboratory in a teaching hospital. Subjects-Thirty-five male mongrel dogs. Interventions-Animals were enrolled to five groups: control, hemodilution with LR or HES 6% to an hematocrit target of 27% or 35%. Results: ICP and CPP levels were measured after cryogenic brain injury. Hemodilution promotes an increment of ICP levels, which decreases CPP when hematocrit target was estimated in 27.% after hemodilution. However, no differences were observed regarding crystalloid or colloid solution used for hemodilution in ICP and CPP levels. Conclusions: Hemodilution to a low hematocrit level increases ICP and decreases CPP scores in dogs submitted to a cryogenic brain injury. These results suggest that excessive hemodilution to a hematocrit below 30% should be avoided in traumatic brain injury patients.