Structure, inheritance, and transcriptional effects of Pce1, an insertional element within Phanerochaete chrysosporium lignin peroxidase gene lipI.

A 1747-bp insertion within a lignin peroxidase allele of Phanerochaete chrysosporium BKM-F-1767 is described. Pce1, the element, lies immediately adjacent to the fourth intron of lip12. Southern blots reveal the presence of Pce1-homologous sequences in other P. chrysosporium strains. Transposon-like features include inverted terminal repeats and a dinucleotide (TA) target duplication. Atypical of transposons, Pce1 is present at very low copy numbers (one to five copies), and conserved transposase motifs are lacking. The mutation transcriptionally inactivates lip12 and is inherited in a 1:1 Mendelian fashion among haploid progeny. Thus, Pce1 is a transposon-like element that may play a significant role in generating ligninolytic variation in certain P. chrysosporium strains.

Effects of retroviral vector design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells.

To determine which features of retroviral vector design most critically affect gene expression in hematopoietic cells in vivo, we have constructed a variety of different retroviral vectors which encode the same gene product, human adenosine deaminase (EC 3.5.4.4), and possess the same vector backbone yet differ specifically in transcriptional control sequences suggested by others to be important for gene expression in vivo. Murine bone marrow cells were transduced by each of the recombinant viruses and subsequently used to reconstitute the hematopoietic system of lethally irradiated recipients. Five to seven months after transplantation, analysis of the peripheral blood of animals transplanted with cells transduced by vectors which employ viral long terminal repeats (LTRs) for gene expression indicated that in 83% (77/93) of these animals, the level of human enzyme was equal to or greater than the level of endogenous murine enzyme. Even in bone marrow transplant recipients reconstituted for over 1 year, significant levels of gene expression were observed for each of the vectors in their bone marrow, spleen, macrophages, and B and T lymphocytes. However, derivatives of the parental MFG-ADA vector which possess either a single base mutation (termed B2 mutation) or myeloproliferative sarcoma virus LTRs rather than the Moloney murine leukemia virus LTRs led to significantly improved gene expression in all lineages. These studies indicate that retroviral vectors which employ viral LTRs for the expression of inserted sequences make it possible to obtain high levels of a desired gene product in most hematopoietic cell lineages for close to the lifetime of bone marrow transplant recipients.

Identification of a retroviroid-like element from plants.

The biological nature of carnation small viroid-like RNA (CarSV RNA), a 275-nt circular molecule with self-cleaving hammerhead structures in its strands of both polarities, was investigated. The lack of infectivity observed in a series of transmission assays in carnation indicates that CarSV RNA, in spite of sharing structural similarities with viroid and viroid-like satellite RNAs from plants, does not belong to either of these two groups. Additional evidence in this direction comes from the observation that CarSV RNA also exists in carnation plants as DNA tandem repeats. In this respect, CarSV RNA is similar to a small transcript of a tandemly repeated DNA sequence of the newt genome. Moreover, CarSV and newt RNAs have similarities in their sequences as well as in some characteristics of their corresponding hammerhead structures. Further analyses have revealed that CarSV DNA is found directly fused to DNA sequences of carnation etched ring caulimovirus, a pararetrovirus, most likely in the form of an extrachromosomal element. The properties of the CarSV RNA/DNA system are those of a retroviroid-like element having some features in common with viroid and viroid-like satellite RNAs from plants and others with the newt transcript.

Three-dimensional structure of a cysteine-rich repeat from the low-density lipoprotein receptor.

The low-density lipoprotein (LDL) receptor plays a central role in mammalian cholesterol metabolism, clearing lipoproteins which bear apolipoproteins E and B-100 from plasma. Mutations in this molecule are associated with familial hypercholesterolemia, a condition which leads to an elevated plasma cholesterol concentration and accelerated atherosclerosis. The N-terminal segment of the LDL receptor contains a heptad of cysteine-rich repeats that bind the lipoproteins. Similar repeats are present in related receptors, including the very low-density lipoprotein receptor and the LDL receptor-related protein/alpha 2-macroglobulin receptor, and in proteins which are functionally unrelated, such as the C9 component of complement. The first repeat of the human LDL receptor has been expressed in Escherichia coli as a glutathione S-transferase fusion protein, and the cleaved and purified receptor module has been shown to fold to a single, fully oxidized form that is recognized by the monoclonal antibody IgG-C7 in the presence of calcium ions. The three-dimensional structure of this module has been determined by two-dimensional NMR spectroscopy and shown to consist of a beta-hairpin structure, followed by a series of beta turns. Many of the side chains of the acidic residues, including the highly conserved Ser-Asp-Glu triad, are clustered on one face of the module. To our knowledge, this structure has not previously been described in any other protein and may represent a structural paradigm both for the other modules in the LDL receptor and for the homologous domains of several other proteins. Calcium ions had only minor effects on the CD spectrum and no effect on the 1H NMR spectrum of the repeat, suggesting that they induce no significant conformational change.

Molecular cloning of the transcription factor TFIIB homolog from Sulfolobus shibatae.

The Archaea (archaebacteria) constitute a group of prokaryotes that are phylogenetically distinct from Eucarya (eukaryotes) and Bacteria (eubacteria). Although Archaea possess only one RNA polymerase, evidence suggests that their transcriptional apparatus is similar to that of Eucarya. For example, Archaea contain a homolog of the TATA-binding protein which interacts with the TATA-box like A-box sequence upstream of many archaeal genes. Here, we report the cloning of a Sulfolobus shibatae gene that encodes a protein (transcription factor TFB) with striking homology to the eukaryotic basal transcription factor TFIIB. We show by primer extension analysis that transcription of the S. shibatae TFB gene initiates 27 bp downstream from a consensus A-box element. Significantly, S. shibatae TFB contains an N-terminal putative metal-binding region and two imperfect direct repeats--structural features that are well conserved in eukaryotic TFIIBs. This suggests that TFB may perform analogous functions in Archaea and Eucarya. Consistent with this, we demonstrate that S. shibatae TFB promotes the binding of S. shibatae TBP to the A-box element of the Sulfolobus 16S/23S rRNA gene. Finally, we show that S. shibatae TFB is significantly more related to TFB of the archaeon Pyrococcus woesei than it is to eukaryotic TFIIBs. These data suggest that TFB arose in the common archaeal/eukaryotic ancestor and that the lineages leading to P. woesei and S. shibatae separated after the divergence of the archaeal and eukaryotic lines of descent.

An n-allele model for progressive amplification in the FMR1 locus.

An n-allele model is developed for the FMR1 locus, which causes the fragile X syndrome, where n is the number of triplet repeats in the first exon. Frequencies in the general population and in index families are used to generate an n to n + delta transition matrix that predicts specific risks in satisfactory agreement with observation. However, until sequencing distinguishes between stable and unstable alleles with the same value of n, it is premature to infer whether allelic frequencies at the FMR1 locus are at equilibrium or, as some have suggested, are evolving toward higher frequencies of the pathogenic allele.

Transposon tagging of tobacco mosaic virus resistance gene N: its possible role in the TMV-N-mediated signal transduction pathway.

Plants can recognize and resist invading pathogens by signaling the induction of rapid defense responses. Often these responses are mediated by single dominant resistance genes (R genes). The products of R genes have been postulated to recognize the pathogen and trigger rapid host defense responses. Here we describe isolation of the classical resistance gene N of tobacco that mediates resistance to the well-characterized pathogen tobacco mosaic virus (TMV). The N gene was isolated by transposon tagging using the maize Activator (Ac) transposon. We confirmed isolation of the N gene by complementation of the TMV-sensitive phenotype with a genomic DNA fragment. Sequence analysis of the N gene shows that it encodes a protein with an amino-terminal domain similar to that of the cytoplasmic domains of the Drosophila Toll protein and the interleukin 1 receptor in mammals, a putative nucleotide-binding site and 14 imperfect leucine-rich repeats. The presence of these functional domains in the predicted N gene product is consistent with the hypothesis that the N resistance gene functions in a signal transduction pathway. Similarities of N to Toll and the interleukin 1 receptor suggest a similar signaling mechanism leading to rapid gene induction and TMV resistance.

Use of Arabidopsis thaliana defense-related mutants to dissect the plant response to pathogens.

The plant defense response to microbial pathogens had been studied primarily by using biochemical and physiological techniques. Recently, several laboratories have developed a variety of pathosystems utilizing Arabidopsis thaliana as a model host so that genetic analysis could also be used to study plant defense responses. Utilizing a pathosystem that involves the infection of Arabidopsis with pathogenic pseudomonads, we have cloned the Arabidopsis disease-resistance gene RPS2, which corresponds to the avirulence gene avrRpt2 in a gene-for-gene relationship. RPS2 encodes a 105-kDa protein containing a leucine zipper, a nucleotide binding site, and 14 imperfect leucine-rich repeats. The RPS2 protein is remarkably similar to the product of the tobacco N gene, which confers resistance to tobacco mosaic virus. We have also isolated a series of Arabidopsis mutants that synthesize decreased levels of an Arabidopsis phytoalexin called camalexin. Analysis of these mutants indicated that camalexin does not play a significant role in limiting growth of avirulent Pseudomonas syringae strains during the hypersensitive defense response but that it may play a role in limiting the growth of virulent strains. More generally, we have shown that we can utilize Arabidopsis to systematically dissect the defense response by isolation and characterization of appropriate defense-related mutants.

Rolling replication of short DNA circles.

Natural genes and proteins often contain tandemly repeated sequence motifs that dramatically increase physiological specificity and activity. Given the selective value of such repeats, it is likely that several different mechanisms have been responsible for their generation. One mechanism that has been shown to generate relatively long tandem repeats (in the kilobase range) is rolling circle replication. In this communication, we demonstrate that rolling circle synthesis in a simple enzymatic system can produce tandem repeats of monomers as short as 34 bp. In addition to suggesting possible origins for natural tandem repeats, these observations provide a facile means for constructing libraries of repeated motifs for use in "in vitro evolution" experiments designed to select molecules with defined biological or chemical properties.

Expressed cadherin pseudogenes are localized to the critical region of the spinal muscular atrophy gene.

Low-copy repeats have been associated with genomic rearrangements and have been implicated in the generation of mutations in several diseases. Here we characterize a subset of low-copy repeats in the spinal muscular atrophy (SMA) region in human chromosome 5q13. We show that this repeated sequence, named c41-cad, is a highly expressed pseudogene derived from an intact neuronal cadherin gene, Br-cadherin, situated on 5p13-14. Br-cadherin is expressed specifically in the brain, whereas the c41-cad transcripts are 10-15 times more abundant and are present in all tissues examined. We speculate that the c41-cad repeats, separately or in concert with other repeats in the SMA region, are involved in the pathogenesis of SMA by promoting rearrangements and deletions.

Pex1, a pollen-specific gene with an extensin-like domain.

We report here the identification of a pollen-specific gene from Zea mays that contains multiple Ser-(Pro)n repeats, the motif found in the cell wall-associated extensins. Sequence analysis reveals that the encoded protein has a putative globular domain at the N terminus and an extensin-like domain at the C terminus. The Pex1 (pollen extensin-like) gene is expressed exclusively in pollen, not in vegetative or female tissues, and is not induced in leaves upon wounding. We propose that the encoded protein may have a role in reproduction, either as a structural element deposited in the pollen tube wall during its rapid growth or as a sexual recognition molecule that interacts with partner molecules in the pistil.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Biochemical characterization and DNA binding properties of the MocR family member GabR, a PLP-dependent transcription factor

GabR è un fattore di trascrizione chimerico appartenente alla famiglia dei MocR/GabR, costituito da un dominio N-terminale elica-giro-elica di legame al DNA e un dominio effettore e/o di oligomerizzazione al C-terminale. I due domini sono connessi da un linker flessibile di 29 aminoacidi. Il dominio C-terminale è strutturalmente omologo agli enzimi aminotransferasici fold-type I, i quali, utilizzando il piridossal-5’-fosfato (PLP) come cofattore, sono direttamente coinvolti nel metabolismo degli aminoacidi. L’interazione contemporanea di PLP e acido γ-aminobutirrico (GABA) a GabR fa sì che questa promuova la trascrizione di due geni, gabT e gabD, implicati nel metabolismo del GABA. GabR cristallizza come un omodimero con una configurazione testa-coda. Il legame con la regione promotrice gabTD avviene attraverso il riconoscimento specifico di due sequenze dirette e ripetute (ATACCA), separate da uno spacer di 34 bp. In questo studio sono state indagate le proprietà biochimiche, strutturali e di legame al DNA della proteina GabR di Bacillus subtilis. L’analisi spettroscopica dimostra che GabR interagisce con il PLP formando l’aldimina interna, mentre in presenza di GABA si ottiene l’aldimina esterna. L’interazione fra il promotore gabTD e le forme holo e apo di GabR è stata monitorata mediante Microscopia a Forza atomica (AFM). In queste due condizioni di legame è stata stimata una Kd di circa 40 ηM. La presenza di GABA invece, determinava un incremento di circa due volte della Kd, variazioni strutturali nei complessi GabR-DNA e una riduzione del compattamento del DNA alla proteina, indipendentemente dalla sequenza del promotore in esame. Al fine di valutare il ruolo delle caratteristiche topologiche del promotore, sono state inserite cinque e dieci bp all’interno della regione spacer che separa le due sequenze ripetute dirette riconosciute da GabR. I significativi cambiamenti topologici riscontrati nel frammento aggiunto di cinque bp si riflettono anche sulla forte riduzione dell’affinità di legame verso la proteina. Al contrario, l’inserzione di 10 bp provoca solamente l’allontanamento delle sequenze ripetute dirette. L’assenza quindi di cambiamenti significativi nella topologia di questo promotore fa sì che l’affinità di legame per GabR rimanga pressoché inalterata rispetto al promotore non mutato. L’analisi del potenziale elettrostatico superficiale di GabR mostra la presenza di una fascia carica positivamente che si estende lungo un’intera faccia della proteina. Per verificare l’importanza di questa caratteristica di GabR nel meccanismo di interazione al DNA, sono stati preparati ed indagati i mutanti R129Q e K362-366Q, in cui la carica positiva superficiale risultava indebolita. L’affinità di legame dei mutanti di GabR per il DNA era inferiore rispetto alla proteina non mutata, in particolar modo nel mutante K362-366Q. Le evidenze acquisite suggeriscono che la curvatura intrinseca del promotore ed il corretto orientamento delle sequenze sulla doppia elica, più della distanza che le separa, siano critici per sostenere l’interazione con GabR. Oltre a questo, la superficie positiva di GabR è richiesta per accomodare la curvatura del DNA sul corpo della proteina. Alla luce di questo, l’interazione GabR-gabTD è un esempio di come il riconoscimento specifico di sequenze, la topologia del DNA e le caratteristiche strutturali della proteina siano contemporaneamente necessarie per sostenere un’interazione proteina-DNA stabile.

Identificação e caracterização de RNA mensageiros candidatos a alvo das proteínas PUMILHO de Arabidopsis através do sistema triplo-híbrido de levedura

Proteínas PUF regulam a estabilidade e a tradução através da ligação a seqüências específicas nas regiões 3\' não traduzidas (3\' UTR) dos mensageiros. A ligação é mediada por um domínio de ligação conservado constituído por 8 repetições de aproximadamente 36 aminoácidos cada. Experimentos realizados no sistema triplo-híbrido de levedura mostraram que os homólogos PUF de Arabidopsis APUM-1, APUM-2 e APUM-3 são capazes de ligar especificamente à seqüência chamada de Elemento de Resposta a NANOS (NRE) reconhecida pelo homólogo PUF de Drosophila. A utilização de bibliotecas de expressão de RNA em ensaios no sistema triplo-híbrido permitiu a identificação de seqüências de ligação consenso para as três proteínas APUM. Análises computacionais identificaram elementos de ligação a APUM em regiões 3\' UTR de importantes transcritos relacionados ao controle do meristema do caule e à manutenção das células totipotentes. Nós mostramos que os homólogos APUM-l, APUM-2 e APUM-3 reconhecem elementos de ligação a APUM nas regiões 3\' UTR dos transcritos WUSCHEL, CLAVATA-1, ZWILLE e FASCIATA-2. Ensaios de RT-PCR e Western blot semiquantitativos mostraram que a quantidade dos transcritos WUSHEL e CLAVATA-1 é alterada em plantas antisenso induzíveis para APUM-l, APUM-2 e APUM-3. A relevância biológica dessas interações foi observada através de ensaios de coimunoprecipitação, confirmando, portanto, o primeiro caso de regulação traducional descrito para os mensageiros WUSCHEL e CLAVATA-1. Análises computacionais adicionais para a identificação de outros homólogos PUF em Arabidopsis encontraram vinte e cinco proteínas possuindo repetições PUF. Entre elas, os homólogos APUM-4, APUM-S e APUM-6 apresentam alta similaridade com as proteínas APUM-l, APUM-2 e APUM-3, sendo capazes de ligar especificamente à seqüência NRE e aos elementos de ligação a APUM presentes nas regiões 3\' UTR dos transcritos WUSCHEL, CLAVATA-1, ZWILLE e FASCIATA-ts resultados indicam que vários homólogos PUF podem agir como reguladores traducionais em Arabidopsis através de um mecanismo molecular conservado entre as espécies, podendo abrir uma nova área de investigação da regulação de mRNA em plantas.

Structural Polymorphism in Tau Filaments: An Implication for Neurodegenerative Diseases

Tau filaments are the pathological hallmark of >20 neurodegenerative diseases including Alzheimer's disease, Pick's disease, and progressive supranuclear palsy. In the adult human brain, six isoforms of tau are expressed that differ by presence or absence of the second of the four semiconserved repeats. As a consequence, half of the tau isoforms have three repeats (3R tau), whereas the other half has four repeats (4R tau). Site-directed spin labeling of recombinant tau in conjunction with electron paramagnetic resonance spectroscopy was used to obtain structural insights into tau filaments. The studies showed that the filaments of 4R tau and 3R tau share a highly ordered core structure in the third repeat with parallel, in-register arrangement of beta-strands. This structure in 3R and 4R is conserved regardless of whether full-length isoforms (htau40 and htau23) or truncated constructs (K18 and K19) are used. When mixed, 3R tau and 4R tau coassembled into heterogeneous filaments. Hence, these findings indicate that there are at least three compositionally distinct types of filaments: homogeneous 3R tau, homogeneous 4R tau, and heterogeneous 3R/4R tau. In vitro experiments show that the seeded filament growth, a prerequisite for tau spreading in tissue culture and brain, is crucially dependent on the isoform composition of individual seeds. Seeds of 3R tau and 3R/4R tau recruit both types of isoforms whereas seeds of 4R tau can recruit 4R tau, but not 3R tau, establishing an asymmetric barrier. Conformational templating of 4R tau onto 3R tau seeds eliminates this barrier, giving rise to a new type of tau filament. Conformational studies at the molecular level of tau filaments were done using Double electron-electron resonance spectroscopy, which allows the determination of distances between pairs of spin labels. These studies revealed structural differences between filaments of 3R tau and 4R tau. Furthermore, they indicated that 4R tau assumed the conformation of 3R tau when templated on 3R tau seeds. Our measurements have also provided insights into the heterogeneity of tau filament structure. Conformational differences due to variation in filament composition and seeding properties of tau filaments have shown that they are structurally polymorphic in nature. This structural polymorphism of tau filaments has widespread implications in understanding and treatment of neurodegenerative diseases.