Ant-caterpillar Antagonism At The Community Level: Interhabitat Variation Of Tritrophic Interactions In A Neotropical Savanna.

Ant foraging on foliage can substantially affect how phytophagous insects use host plants and represents a high predation risk for caterpillars, which are important folivores. Ant-plant-herbivore interactions are especially pervasive in cerrado savanna due to continuous ant visitation to liquid food sources on foliage (extrafloral nectaries, insect honeydew). While searching for liquid rewards on plants, aggressive ants frequently attack or kill insect herbivores, decreasing their numbers. Because ants vary in diet and aggressiveness, their effect on herbivores also varies. Additionally, the differential occurrence of ant attractants (plant and insect exudates) on foliage produces variable levels of ant foraging within local floras and among localities. Here, we investigate how variation of ant communities and of traits among host plant species (presence or absence of ant attractants) can change the effect of carnivores (predatory ants) on herbivore communities (caterpillars) in a cerrado savanna landscape. We sampled caterpillars and foliage-foraging ants in four cerrado localities (70-460 km apart). We found that: (i) caterpillar infestation was negatively related with ant visitation to plants; (ii) this relationship depended on local ant abundance and species composition, and on local preference by ants for plants with liquid attractants; (iii) this was not related to local plant richness or plant size; (iv) the relationship between the presence of ant attractants and caterpillar abundance varied among sites from negative to neutral; and (v) caterpillars feeding on plants with ant attractants are more resistant to ant predation than those feeding on plants lacking attractants. Liquid food on foliage mediates host plant quality for lepidopterans by promoting generalized ant-caterpillar antagonism. Our study in cerrado shows that the negative effects of generalist predatory ants on herbivores are detectable at a community level, affecting patterns of abundance and host plant use by lepidopterans. The magnitude of ant-induced effects on caterpillar occurrence across the cerrado landscape may depend on how ants use plants locally and how they respond to liquid food on plants at different habitats. This study enhances the relevance of plant-ant and ant-herbivore interactions in cerrado and highlights the importance of a tritrophic perspective in this ant-rich environment.

Partitioning The Net Effect Of Host Diversity On An Emerging Amphibian Pathogen.

The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.

Contrasting Effects Of Land Use Intensity And Exotic Host Plants On The Specialization Of Interactions In Plant-herbivore Networks.

Human land use tends to decrease the diversity of native plant species and facilitate the invasion and establishment of exotic ones. Such changes in land use and plant community composition usually have negative impacts on the assemblages of native herbivorous insects. Highly specialized herbivores are expected to be especially sensitive to land use intensification and the presence of exotic plant species because they are neither capable of consuming alternative plant species of the native flora nor exotic plant species. Therefore, higher levels of land use intensity might reduce the proportion of highly specialized herbivores, which ultimately would lead to changes in the specialization of interactions in plant-herbivore networks. This study investigates the community-wide effects of land use intensity on the degree of specialization of 72 plant-herbivore networks, including effects mediated by the increase in the proportion of exotic plant species. Contrary to our expectation, the net effect of land use intensity on network specialization was positive. However, this positive effect of land use intensity was partially canceled by an opposite effect of the proportion of exotic plant species on network specialization. When we analyzed networks composed exclusively of endophagous herbivores separately from those composed exclusively of exophagous herbivores, we found that only endophages showed a consistent change in network specialization at higher land use levels. Altogether, these results indicate that land use intensity is an important ecological driver of network specialization, by way of reducing the local host range of herbivore guilds with highly specialized feeding habits. However, because the effect of land use intensity is offset by an opposite effect owing to the proportion of exotic host species, the net effect of land use in a given herbivore assemblage will likely depend on the extent of the replacement of native host species with exotic ones.

Removal Of Glyphosate Herbicide From Water Using Biopolymer Membranes.

Enormous amounts of pesticides are manufactured and used worldwide, some of which reach soils and aquatic systems. Glyphosate is a non-selective herbicide that is effective against all types of weeds and has been used for many years. It can therefore be found as a contaminant in water, and procedures are required for its removal. This work investigates the use of biopolymeric membranes prepared with chitosan (CS), alginate (AG), and a chitosan/alginate combination (CS/AG) for the adsorption of glyphosate present in water samples. The adsorption of glyphosate by the different membranes was investigated using the pseudo-first order and pseudo-second order kinetic models, as well as the Langmuir and Freundlich isotherm models. The membranes were characterized regarding membrane solubility, swelling, mechanical, chemical and morphological properties. The results of kinetics experiments showed that adsorption equilibrium was reached within 4 h and that the CS membrane presented the best adsorption (10.88 mg of glyphosate/g of membrane), followed by the CS/AG bilayer (8.70 mg of glyphosate/g of membrane). The AG membrane did not show any adsorption capacity for this herbicide. The pseudo-second order model provided good fits to the glyphosate adsorption data on CS and CS/AG membranes, with high correlation coefficient values. Glyphosate adsorption by the membranes could be fitted by the Freundlich isotherm model. There was a high affinity between glyphosate and the CS membrane and moderate affinity in the case of the CS/AG membrane. Physico-chemical characterization of the membranes showed low values of solubility in water, indicating that the membranes are stable and not soluble in water. The SEM and AFM analysis showed evidence of the presence of glyphosate on CS membranes and on chitosan face on CS/AG membranes. The results showed that the glyphosate herbicide can be adsorbed by chitosan membranes and the proposed membrane-based methodology was successfully used to treat a water sample contaminated with glyphosate. Biopolymer membranes therefore potentially offer a versatile method to eliminate agricultural chemicals from water supplies.

Convergence Of Soil Nitrogen Isotopes Across Global Climate Gradients.

Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.

Engineered Nanoparticles And Organic Matter: A Review Of The State-of-the-art.

Growth in the development and production of engineered nanoparticles (ENPs) in recent years has increased the potential for interactions of these nanomaterials with aquatic and terrestrial environments. Carefully designed studies are therefore required in order to understand the fate, transport, stability, and toxicity of nanoparticles. Natural organic matter (NOM), such as the humic substances found in water, sediment, and soil, is one of the substances capable of interacting with ENPs. This review presents the findings of studies of the interaction of ENPs and NOM, and the possible effects on nanoparticle stability and the toxicity of these materials in the environment. In addition, ENPs and NOM are utilized for many different purposes, including the removal of metals and organic compounds from effluents, and the development of new electronic sensors and other devices for the detection of active substances. Discussion is therefore provided of some of the ways in which NOM can be used in the production of nanoparticles. Although there has been an increase in the number of studies in this area, further progress is needed to improve understanding of the dynamic interactions between ENPs and NOM.

Comparative Study Of Transgenic And Non-transgenic Maize (zea Mays) Flours Commercialized In Brazil, Focussing On Proteomic Analyses.

Genetically modified foods are a major concern around the world due to the lack of information concerning their safety and health effects. This work evaluates differences, at the proteomic level, between two types of crop samples: transgenic (MON810 event with the Cry1Ab gene, which confers resistance to insects) and non-transgenic maize flour commercialized in Brazil. The 2-D DIGE technique revealed 99 differentially expressed spots, which were collected in 2-D PAGE gels and identified via mass spectrometry (nESI-QTOF MS/MS). The abundance of protein differences between the transgenic and non-transgenic samples could arise from genetic modification or as a result of an environmental influence pertaining to the commercial sample. The major functional category of proteins identified was related to disease/defense and, although differences were observed between samples, no toxins or allergenic proteins were found.

Ecotoxicological Effects Of Carbofuran And Oxidised Multiwalled Carbon Nanotubes On The Freshwater Fish Nile Tilapia: Nanotubes Enhance Pesticide Ecotoxicity.

The interactions of carbon nanotubes with pesticides, such as carbofuran, classical contaminants (e.g., pesticides, polyaromatic hydrocarbons, heavy metals, and dyes) and emerging contaminants, including endocrine disruptors, are critical components of the environmental risks of this important class of carbon-based nanomaterials. In this work, we studied the modulation of acute carbofuran toxicity to the freshwater fish Nile tilapia (Oreochromis niloticus) by nitric acid treated multiwalled carbon nanotubes, termed HNO3-MWCNT. Nitric acid oxidation is a common chemical method employed for the purification, functionalisation and aqueous dispersion of carbon nanotubes. HNO3-MWCNT were not toxic to Nile tilapia at concentrations ranging from 0.1 to 3.0 mg/L for exposure times of up to 96 h. After 24, 48, 72 and 96 h, the LC50 values of carbofuran were 4.0, 3.2, 3.0 and 2.4 mg/mL, respectively. To evaluate the influence of carbofuran-nanotube interactions on ecotoxicity, we exposed the Nile tilapia to different concentrations of carbofuran mixed together with a non-toxic concentration of HNO3-MWCNT (1.0 mg/L). After 24, 48, 72, and 96 h of exposure, the LC50 values of carbofuran plus nanotubes were 3.7, 1.6, 0.7 and 0.5 mg/L, respectively. These results demonstrate that HNO3-MWCNT potentiate the acute toxicity of carbofuran, leading to a more than five-fold increase in the LC50 values. Furthermore, the exposure of Nile tilapia to carbofuran plus nanotubes led to decreases in both oxygen consumption and swimming capacity compared to the control. These findings indicate that carbon nanotubes could act as pesticide carriers affecting fish survival, metabolism and behaviour.

Competição larval em Chrysomya megacephala (F.) (Diptera: Calliphoridae): efeitos de diferentes níveis de agregação larval sobre estimativas de peso, fecundidade e investimento reprodutivo

In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.

Um novo índice de qualidade das águas para proteção da vida aquática aplicado ao Rio Atibaia, região de Campinas/Paulínia-SP

In this paper a water quality index is developed to subsidize management actions in the Atibaia River for upon protection of aquatic organisms. This index is composed of two measurable environmental parameters normaly, ammonia and dissolved oxygen, the latter representing the contribution of organic matter. Concentrations of these two variables were normalized on a scale from 0 to 100 and translated into statements of quality (excellent, good, regular, bad and very bad). The index was applied to three monitoring points in the Atibaia River and compared to other indices used by the State of São Paulo Environmental Agency (CETESB). The results showed that the degradation in this watershed follows the urban population density. The developed index is more restricted than the other ones routinely used to infer water quality.

Interferentes endócrinos no ambiente

Although the hypothesis that environmental chemicals may exhibit endocrine disrupting effects is not new, the issue has been a growing level of concern due to reports of increased incidences of endocrine-related disease in humans, including declining male fertility, and more significantly, to adverse physiological effects observed in wildlife where cause and effect relationships are more evident. The list of endocrine disrupting chemicals (EDCs) includes a range of anthropogenic compounds, phytoestrogens, naturally occurring sex steroids and synthetic estrogens. Within the aquatic environment, the presence of EDCs has concerned many scientists and water quality regulators. Discharge of effluents from treatment facilities is likely to be a significant source of input of contaminants to many systems, and the potential for concentration of hydrophilic compounds and transformation products within sludges has implications for their disposal. Then, understanding the processes and the fate of EDCs on the environment, as well as the mechanisms of endocrine disruption, may facilitate controlling or limiting exposure of both humans and the environment to these compounds.

Alteração da atividade enzimática em organismos aquáticos por poluentes de origem agrícola: uma abordagem geral e sobre a suscetibilidade da fosfatase ácida

The input of agrochemicals in the aquatic compartment can results in biochemical injuries for living organisms. In this context, the knowledge of alterations of enzymatic activities due the presence of agriculture pollutants contributes for the elucidation of the mechanisms of toxicity, implementation of economic methods for monitoring purposes and establishment of maximum allowed concentrations. In the present work, the above considerations are discussed, and data concerning changes in enzymatic function by pesticides and fertilizer contaminants are reviewed. Also, we focused on the acid phosphatase due its susceptibility to several pollutants and diversity in cellular functions.

Sulfetos volatilizáveis por acidificação e metais extraídos simultaneamente na avaliação de sedimentos de água doce

This paper discusses the historical and methodological fundaments of the dynamics and quantification of acid volatile sulfides (AVS) and simultaneously extracted metals (SEM) in aquatic sediments. It also discusses the SEM/AVS relationship, which involves several controversial aspects such as sulfide stability, sulfide-organic matter interaction, and the inability to predict the toxicity of organic compounds in the environment. This relationship is an important tool for the inference of metal bioavailability. The use of ecotoxicological tests with target organisms regulated by international standards is also a relevant aspect.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Indicadores dermatoglificos de aptidão fisica e efeito dos treinamentos intervalado versus continuo na pratica da corrida em piscina funda : intervenção com mulheres obesas

Universidade Estadual de Campinas . Faculdade de Educação Física