A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Tree structure and richness in an Atlantic Forest fragment: distance from anthropogenic and natural edges

Approximately 7.2% of the Atlantic rainforest remains in Brazil, with only 16% of this forest remaining in the State of Rio de Janeiro, all of it distributed in fragments. This forest fragmentation can produce biotic and abiotic differences between edges and the fragment interior. In this study, we compared the structure and richness of tree communities in three habitats - an anthropogenic edge (AE), a natural edge (NE) and the fragment interior (FI) - of a fragment of Atlantic forest in the State of Rio de Janeiro, Brazil (22°50'S and 42°28'W). One thousand and seventy-six trees with a diameter at breast height > 4.8 cm, belonging to 132 morphospecies and 39 families, were sampled in a total study area of 0.75 ha. NE had the greatest basal area and the trees in this habitat had the greatest diameter:height allometric coefficient, whereas AE had a lower richness and greater variation in the height of the first tree branch. Tree density, diameter, height and the proportion of standing dead trees did not differ among the habitats. There was marked heterogeneity among replicates within each habitat. These results indicate that the forest interior and the fragment edges (natural or anthropogenic) do not differ markedly considering the studied parameters. Other factors, such as the age from the edge, type of matrix and proximity of gaps, may play a more important role in plant community structure than the proximity from edges.

Levantamento fitossociológico e caráter sucessional de um trecho de floresta secundária ciliar em Juquitiba, SP, Brasil

The objective of this study was to evaluate the horizontal and vertical structures of tree community in regeneration in a fragment of a secondary riparian forest at approximately 30 years of age and to identify the most abundant species in each fragment of the forest to determine the sucessional stage. An area of 800 m² was subdivided into 16 samples of 10 x 5 m and all individuals with DBH ≥ 1 cm were sampled and identified for the following analyzes: horizontal parameters (DR, FR, DoR, IVC and IVI), vertical parameters (PSR and RNR) and mixed parameters, from of value of increased importance index (IVIa). The survey measured 689 individuals, belonging to 38 families, 74 genus and 109 species. The total density was 8,614 individuals/ha. The index of Shannon´s diversity was 3.99 and the index of Pielou´s equability was 0.85. Tibouchina pulchra, Psychotria suterella and Endlicheria paniculata obtained high values of IVIa. Guarea macrophylla, Gomidesia anacardiaefolia, Xylopia langsdorffiana and Endlicheria paniculata achieved high values of RNT, indicating adequate natural regeneration in the plot. The initial secondary and umbrophylous species showed the highest ecological importance in this fragment of the forest, with the highest values of sociologic position and importance index. Furthermore, the presence of late secondary species in all layers suggest that the studied fragment is in intermediate succession degree.

Variabilidade espacial de atributos físicos de um argissolo vermelho-amarelo sob pastagem e vegetação secundária em regeneração natural

This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Structure of the understory community in four stretches of Araucaria forest in the state of São Paulo, Brazil

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Educação fisica escolar : proposta para formação de lideres comunitarios para alunos de 2ª e 3ª series do ensino medio

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise transversal da estrutura óssea e parâmetros hematológicos em futebolistas profissionais = : Cross-sectional analysis of bone structure and hematological parameters in professional soccer players

Universidade Estadual de Campinas. Faculdade de Educação Física

1. Jogos Escolares Brasileiros da Confederação Brasileira de Desportos para Cegos : um estudo de caso

Universidade Estadual de Campinas . Faculdade de Educação Física

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Evaluation of the dental structure loss produced during maintenance and replacement of occlusal amalgam restorations

The aim of this in vitro study was to evaluate four different approaches to the decision of changing or not defective amalgam restorations in first primary molar teeth concerning the loss of dental structure. Ditched amalgam restorations (n = 11) were submitted to four different treatments, as follows: Control group - polishing and finishing of the restorations were carried out; Amalgam group - the ditched amalgam restorations were replaced by new amalgam restorations; Composite resin group - the initial amalgam restorations were replaced by composite resin restorations; Flowable resin group - the ditching around the amalgam restorations was filled with flowable resin. Images of the sectioned teeth were made and the area of the cavities before and after the procedures was determined by image analysis software to assess structural loss. The data were submitted to ANOVA complemented by the Student Newman Keuls test (p < 0.05). The cavities in all the groups presented significantly greater areas after the procedures. However, the amalgam group showed more substantial dental loss. The other three groups presented no statistically significant difference in dental structure loss after the re-treatments. Thus, replacing ditched amalgam restorations by other similar restorations resulted in a significant dental structure loss while maintaining them or replacing them by resin restorations did not result in significant loss.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.