970 resultados para reaaliaikainen PCR
Resumo:
This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.
Resumo:
Human exposure to Bartonella clarridgeiae has been reported only on the basis of antibody detection. We report for the first time an asymptomatic human blood donor infected with B. clarridgeiae, as documented by enrichment blood culture, PCR, and DNA sequencing.
Resumo:
Placental tissue injury is concomitant with tumor development. We investigated tumor-driven placental damage by tracing certain steps of the protein synthesis and degradation pathways under leucine-rich diet supplementation in MAC16 tumor-bearing mice. Cell signaling and ubiquitin-proteasome pathways were assessed in the placental tissues of pregnant mice, which were distributed into three groups on a control diet (pregnant control, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid) and three other groups on a leucine-rich diet (pregnant, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid). MAC tumor growth down-regulated the cell-signaling pathways of the placental tissue and decreased the levels of IRS-1, Akt/PKB, Erk/MAPK, mTOR, p70S6K, STAT3, and STAT6 phosphorylated proteins, as assessed by the multiplex Millipore Luminex assay. Leucine supplementation maintained the levels of these proteins within the established cell-signaling pathways. In the tumor-bearing group (MAC) only, the placental tissue showed increased PC5 mRNA expression, as assessed by quantitative RT-PCR, decreased 19S and 20S protein expression, as assessed by Western blot analysis, and decreased placental tyrosine levels, likely reflecting up-regulation of the ubiquitin-proteasome pathway. Similar effects were found in the pregnant injected with MAC-ascitic fluid group, confirming that the effects of the tumor were mimicked by MAC-ascitic fluid injection. Although tumor progression occurred, the degradation pathway-related protein levels were modulated under leucine-supplementation conditions. In conclusion, tumor evolution reduced the protein expression of the cell-signaling pathway associated with elevated protein degradation, thereby jeopardizing placental activity. Under the leucine-rich diet, the impact of cancer on placental function could be minimized by improving the cell-signaling activity and reducing the proteolytic process.
Resumo:
Maternal high-fat diet (HFD) impairs hippocampal development of offspring promoting decreased proliferation of neural progenitors, in neuronal differentiation, in dendritic spine density and synaptic plasticity reducing neurogenic capacity. Notch signaling pathway participates in molecular mechanisms of the neurogenesis. The activation of Notch signaling leads to the upregulation of Hes5, which inhibits the proliferation and differentiation of neural progenitors. This study aimed to investigate the Notch/Hes pathway activation in the hippocampus of the offspring of dams fed an HFD. Female Swiss mice were fed a control diet (CD) and an HFD from pre-mating until suckling. The bodyweight and mass of adipose tissue in the mothers and pups were also measured. The mRNA and protein expression of Notch1, Hes5, Mash1, and Delta1 in the hippocampus was assessed by RT-PCR and western blotting, respectively. Dams fed the HFD and their pups had an increased bodyweight and amount of adipose tissue. Furthermore, the offspring of mothers fed the HFD exhibited an increased Hes5 expression in the hippocampus compared with CD offspring. In addition, HFD offspring also expressed increased amounts of Notch1 and Hes5 mRNA, whereas Mash1 expression was decreased. However, the expression of Delta1 did not change significantly. We propose that the overexpression of Hes5, a Notch effector, downregulates the expression of the proneural gene Mash1 in the offspring of obese mothers, delaying cellular differentiation. These results provide further evidence that an offspring's hippocampus is molecularly susceptible to maternal HFD and suggest that Notch1 signaling in this brain region is important for neuronal differentiation.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.
Resumo:
This study analyzed the association of periodontal disease (PD) and rheumatoid arthritis (RA). Seventy-five 35-60-year-old patients were assigned to 5 groups according to the presence (+) or not (-) of PD and RA and the treatment received (TR+) or not (TR-) for PD. Group 3 uses total prosthesis (TP). Clinical and laboratory evaluations were performed at baseline, 3 and 6 months of follow-up by probing pocket depth, bleeding on probing and plaque index for PD, HAQ, DAS28, SF-36 and laboratory: AAG, ESR, CRP for RA. Statistically significant differences for PD after 3 (p=0.0055) and after 6 months (p=0.0066) were obtained in Group 1 (RA+PD+TR+) and 2(RA+PD+TR-); significant reduction in the % of BOP after 6 months (p=0.0128) and significant reduction in the % of Pl after 3 (p=0.0128) and 6 months (p=0.0002) in Group 1. Statistically significant differences between Groups 1 and 3 (RA+TP) for DAS28 at baseline and after 3 months were observed, but not after 6 months. No other parameters for RA were significantly affected. The relationship between RA and PD disease activities is not clear, but the importance of periodontal treatment in the control of inflammation to avoid tooth extraction is evident.
Resumo:
INTRODUCTION: This study evaluated whether leprosy reactions could be associated with oral infection. METHODS: Leprosy patients (n = 38) with (Group I) and without (Group II) oral infections were selected. Reactions were identified from the clinical and histopathological features associated with serum C-reactive protein (CRP) and10kDa interferon-gamma-induced protein (IP-10) levels, determined before and after elimination of the foci of infection. RESULTS: Group I presented more reactions than group II did, and improvement of the reactions after dental treatment. Serum CRP and IP-10 did not differ before and after the dental treatment, but differed between the groups. CONCLUSIONS: Oral infection could be an exacerbating factor in leprosy reactions.