916 resultados para diversity-disease relationship
Resumo:
Whipple's disease (WD) is an uncommon multisystem condition caused by the bacillus Tropheryma whipplei. Central nervous system involvement is a classical feature of the disease observed in 20 to 40% of the patients. We report the case of a 62 yeards old man with WD that developed neurological manifestations during its course, and discuss the most usual signs and symptoms focusing on recent diagnostic criteria and novel treatment regimens.
Resumo:
This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.
Resumo:
Epilepsy is a common chronic condition in the childhood and its diagnosis reveals psychological, social and family difficulties, that seem to be related with beliefs and quality of parents-children interaction. The purpose of this paper is to schematize investigation strategies for the psychological variables: beliefs, impact of the disease, family relationship, identification of changes. Based upon collected reports of epileptic children's parents and upon surveyed aspects of the literature, psychological questionnaires were elaborated to identify important variables that affect the child's epilepsy life and his family. The use of more appropriate investigation procedures facilitates the psychological evaluation and ensures the collection of data.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
OBJECTIVE: This epidemiological survey assessed the dental caries profile in Monte Negro, a small town in the Amazonian state of Rondônia, Brazil, and its relationship with the northern region, national and global goals for oral health in the years 2000 and 2020. MATERIAL AND METHODS: The groups randomly examined were composed of individuals aged 5, 12, 15 to 19, 35 to 44, 65 to 74 years, living in both rural and urban areas. RESULTS: The means dft (standard deviation) and DMFT (standard deviation) for the groups were, respectively, 3.15 (3.12), 3.41 (2.69), 5.96 (4.19), 16.00 (7.30) and 25.96 (9.82). Caries-free individuals were 34.42%, 14.81% and 8.16% in the preschoolchildren, schoolchildren and adolescent groups, respectively. The Significant Caries Index percentages applied to the two younger groups were 6.65 and 6.70, and they increased to 32.00 in the individuals aged 65 to 74 years. Care Index percentages for adolescents, adults and elderly groups were, respectively, 29.40, 25.00 and 1.41. The dental caries profile in Monte Negro in 2008 shows that, 8 years after the year 2000, no FDI/WHO goal for any age settled in 1982 has been achieved. Dental caries increased with age and the main dental problem of adult and elderly groups was tooth loss. CONCLUSION: Oral health promotion and prevention of oral disease policies are urgent needs. Setting of oral health goals and targets to people living in Monte Negro or Amazonia to be pursuit and achieved in a near future is an important action to do because of the culture, sanitary conditions and socioeconomic aspects of this particular population.
Resumo:
Dental caries is a transmissible infectious disease in which mutans streptococci are generally considered to be the main etiological agents. Although the transmissibility of dental caries is relatively well established in the literature, little is known whether information regarding this issue is correctly provided to the population. The present study aimed at evaluating, by means of a questionnaire, the knowledge and usual attitude of 640 parents and caretakers regarding the transmissibility of caries disease. Most interviewed adults did not know the concept of dental caries being an infectious and transmissible disease, and reported the habit of blowing and tasting food, sharing utensils and kissing the children on their mouth. 372 (58.1%) adults reported that their children had already been seen by a dentist, 264 (41.3%) answered that their children had never gone to a dentist, and 4 (0.6%) did not know. When the adults were asked whether their children had already had dental caries, 107 (16.7%) answered yes, 489 (76.4%) answered no, and 44 (6.9%) did not know. Taken together, these data reinforce the need to provide the population with some important information regarding the transmission of dental caries in order to facilitate a more comprehensive approach towards the prevention of the disease.
Resumo:
Adjunctive therapeutic strategies that modulate the inflammatory mediators can play a significant role in periodontal therapy. In this double-blind, placebo-controlled study, 60 subjects diagnosed as periodontitis patients were evaluated for 28 days after periodontal treatment combined with selective cyclooxygenase-2 (COX-2) inhibitor. The experimental group received scaling and root planning (SRP) combined with the Loxoprofen antiinflammatory drug (SRP+Loxoprofen). The control group received SRP combined with placebo (SRP+placebo). Plaque index (PI), probing pocket depth (PD) and bleeding on probing (BOP) were monitored with an electronic probe at baseline and after 14 and 28 days. Both groups displayed clinical improvement in PD, PI and BOP. They also showed statistically similar values (p>0.05) of PD reduction on day 14 (0.4 mm) and on day 28 (0.6 mm). At the baseline, few deeper sites (>7 mm) from SRP+Loxoprofen group were responsible and most PD reduction was observed after 14 days (p<0.05). The percentage of remaining deep pockets (>7 mm) after 14 days in the SRP+Loxoprofen group was significantly lower (p<0.05) than in the SRP+placebo group. Loxoprofen presents potential effect as an adjunct of periodontal disease treatment, but long-term clinical trials are necessary to confirm its efficacy.
Resumo:
The objective of the present study was to determine whether lesion of the subthalamic nucleus (STN) promoted by N-methyl-D-aspartate (NMDA) would rescue nigrostriatal dopaminergic neurons after unilateral 6-hydroxydopamine (6-OHDA) injection into the medial forebrain bundle (MFB). Initially, 16 mg 6-OHDA (6-OHDA group) or vehicle (artificial cerebrospinal fluid - aCSF; Sham group) was infused into the right MFB of adult male Wistar rats. Fifteen days after surgery, the 6-OHDA and SHAM groups were randomly subdivided and received ipsilateral injection of either 60 mM NMDA or aCSF in the right STN. Additionally, a control group was not submitted to stereotaxic surgery. Five groups of rats were studied: 6-OHDA/NMDA, 6-OHDA/Sham, Sham/NMDA, Sham/Sham, and Control. Fourteen days after injection of 6-OHDA, rats were submitted to the rotational test induced by apomorphine (0.1 mg/kg, ip) and to the open-field test. The same tests were performed again 14 days after NMDA-induced lesion of the STN. The STN lesion reduced the contralateral turns induced by apomorphine and blocked the progression of motor impairment in the open-field test in 6-OHDA-treated rats. However, lesion of the STN did not prevent the reduction of striatal concentrations of dopamine and metabolites or the number of nigrostriatal dopaminergic neurons after 6-OHDA lesion. Therefore, STN lesion is able to reverse motor deficits after severe 6-OHDA-induced lesion of the nigrostriatal pathway, but does not protect or rescue dopaminergic neurons in the substantia nigra pars compacta.
Resumo:
Aggregatibacter actinomycetemcomitans is an important etiologic agent of the periodontitis and is associated with extra-oral infections. In this study, the detection of the ltxA gene as well as the ltx promoter region from leukotoxic A. actinomycetemcomitans isolated from 50 Brazilian patients with periodontitis and 50 healthy subjects was performed. The leukotoxic activity on HL-60 cells was also evaluated. Leukotoxic activity was determined using a trypan blue exclusion method. The 530 bp deletion in the promoter region was evaluated by PCR using a PRO primer pair. A. actinomycetemcomitans was detected by culture and directly from crude subgingival biofilm by PCR using specific primers. By culture, A. actinomycetemcomitans was detected in nine (18%) of the periodontal patients and one (2%) healthy subject. However, by PCR, this organism was detected in 44% of the periodontal patients and in 16% of the healthy subjects. It was verified a great discrepancy between PCR detection of the ltx operon promoter directly from crude subgingival biofilm and from bacterial DNA. Only one periodontal sample harbored highly leukotoxic A. actinomycetemcomitans. Moreover, biotype II was the most prevalent and no correlation between biotypes and leukotoxic activity was observed. The diversity of leukotoxin expression by A. actinomycetemcomitans suggests a role of this toxin in the pathogenesis of periodontal disease and other infectious diseases.