Effects of Perilipin (PLIN) Gene Variation on Metabolic Syndrome Risk and Weight Loss in Obese Children and Adolescents

Context: Genetic polymorphisms at the perilipin (PLIN) locus have been investigated for their potential utility as markers for obesity and metabolic syndrome (MS). We examined in obese children and adolescents (OCA) aged 7-14 yr the association of single-nucleotide polymorphisms (SNP) at the PLIN locus with anthropometric, metabolic traits, and weight loss after 20-wk multi-disciplinary behavioral and nutritional treatment without medication. Design: A total of 234 OCA [body mass index (BMI = 30.4 +/- 4.4 kg/m(2); BMI Z-score = 2.31 +/- 0.4) were evaluated at baseline and after intervention. We genotyped four SNPs (PLIN1 6209T -> C, PLIN4 11482G -> A, PLIN5 13041A -> G, and PLIN6 14995A -> T). Results: Allele frequencies were similar to other populations, PLIN1 and PLIN4 were in linkage disequilibrium (D` = 0.999; P < 0.001). At baseline, no anthropometric differences were observed, but minor allele A at PLIN4 was associated with higher triglycerides (111 +/- 49 vs. 94 +/- 42 mg/dl; P = 0.003), lower high-density lipoprotein cholesterol (40 +/- 9 vs. 44 +/- 10 mg/dl; P = 0.003) and higher homeostasis model assessment for insulin resistance (4.0 +/- 2.3 vs. 3.5 +/- 2.1; P +/- 0.015). Minor allele A at PLIN4 was associated with MS risk (age and sex adjusted) hazard ratio 2.4 (95% confidence interval = 1.1-4.9) for genotype GA and 3.5 (95% confidence interval = 1.2-9.9) for AA. After intervention, subjects carrying minor allele T at PLIN6 had increased weight loss (3.3 +/- 3.7 vs. 1.9 +/- 3.4 kg; P = 0.002) and increased loss of the BMI Z-score (0.23 +/- 0.18 vs. 0.18 +/- 0.15; P +/- 0.003). Due to group size, risk of by-chance findings cannot be excluded. Conclusion: The minor A allele at PLIN4 was associated with higher risk of MS at baseline, whereas the PLIN6 SNP was associated with better weight loss, suggesting that these polymorphisms may predict outcome strategies based on multidisciplinary treatment for OCA. (J Clin Endocrinol Metab 93: 4933-4940, 2008)

Maternal and neonatal interleukin-1 receptor antagonist genotype and pregnancy outcome in a population with a high rate of pre-term birth

Problem We evaluated associations between a length polymorphism in intron 2 of the gene coding for IL-1ra (gene symbol IL1RN) and pregnancy outcome in a population with a high rate of preterm birth. Method of study Subjects were pregnant women in Maceio, Brazil and their newborns. DNA was tested for IL1RN genotypes and alleles by gene amplification using primer pairs that spanned the polymorphic region. Every subject completed a detailed questionnaire. Results The frequency of allele 2 (IL1RN*2) carriage was elevated in mothers with a spontaneous preterm birth (SPTB) in the current pregnancy (P = 0.02) and also with a prior preterm delivery (P = .01). Both SPTB with intact membranes (P = 0.01) and SPTB preceded by pre-term pre-mature rupture of membranes (P = .03) were associated with IL1RN*2 carriage. A previous fetal demise was more than twice as prevalent in mothers positive for two copies of IL1RN*2. Conclusion Maternal carriage of IL1RN*2 increases susceptibility to inflammation-triggered spontaneous pre-term birth.

The common p450 oxidoreductase variant A503V is not a modifier gene for 21-hydroxylase deficiency

Context: 21-hydroxylase deficiency (21OHD) is a common genetic disorder caused by mutations in the CYP21A2 gene, which encodes the adrenal 21-hydroxylase, microsomal P450c21. CYP21A2 gene mutations generally correlate well with impaired P450c21 enzymatic activity and the clinical findings in 21OHD, but occasional discrepancies between genotype and phenotype suggest the effects of modifier genes. Mutations in P450 oxidoreductase (POR), the protein that transfers electrons from reduced nicotinamide adenine dinucleotide phosphate to all microsomal P450s, can ameliorate the 21OHD phenotype and, therefore, could be a modifier gene. Objectives: We sought to identify POR variants in patients with 21OHD having discordant phenotype and genotype, and to evaluate their effect on 21-hydroxylase activity. Patients and Methods: We determined the CYP21A2 genotypes of 313 Brazilian patients with 21OHD and correlated the genotype and phenotype. The POR gene was sequenced in 17 patients with discordant genotype and phenotype. Wild-type and A503V POR, and P450c21 were expressed in bacteria and reconstituted in vitro. Activities were assayed by conversion of [C-14] progesterone to deoxycorticosterone and [H-3]17-hydroxyprogesterone to 11-deoxycortisol, and assessed by thin layer chromatography and phosphorimaging. Results: The A503V POR variant was found in 10 of 30 alleles, the same ratio as in the normal population. There were no significant differences in Michaelis constant, maximum velocity and maximum velocity/Michaelis constant of 21-hydroxylase activity supported by wild-type and A503V POR. Conclusion: The only POR missense polymorphism found in atypical 21OHD patients was A503V. Although A503V reduces P450c17 enzymatic activity, it does not influence P450c21 activity, indicating that POR A503V does not modify the 21OHD phenotype.

The degree of external genitalia virilization in girls with 21-hydroxylase deficiency appears to be influenced by the CAG repeats in the androgen receptor gene

Background Women with 21-hydroxylase deficiency present much variability in external genitalia virilization, even among those with similar impairments of 21-hydroxylase (21OH) activity. Objective To evaluate if the number of CAG (nCAG) repeats of the androgen receptor gene influences the degree of external genitalia virilization in women with CYP21A2 mutations, grouped according to impairment of 21OH activity. Patients The nCAG was determined in 106 congenital adrenal hyperplasia (CAH) patients and in 302 controls. The patients were divided, according to their CYP21A2 genotypes, into Groups A and B, which confer total and severe impairment of 21OH activity, respectively. Methods The inactivation pattern of the X-chromosome was studied through genomic DNA digestion with Hpa II. The CAG repeat region was amplified by polymerase chain reaction (PCR) and analysed by GeneScan. Results The nCAG and the frequency of severe skewed X-inactivation did not differ between normal women and patients. The nCAG median in genotype A was 20.7 (IQR 2.3) for Prader I + II, 22.5 (3.6) for Prader III and 21 (2.9) for Prader IV + V (P < 0.05 for Prader III and Prader IV + V). The nCAG median in genotype B was 21.3 (1.1) for Prader I + II, 20.5 (2.9) for Prader III and 22 (2.8) for Prader IV + V (P > 0.05). A significant difference was found regarding the nCAG median in patients presenting Prader III from genotypes A and B. Conclusions We observed great variability in the degree of external genitalia virilization in both CYP21A2 genotypes, and we showed that the CAG repeats of the androgen receptor gene influences this phenotypic variability.

The Role of SRY Mutations in the Etiology of Gonadal Dysgenesis in Patients with 45,X/46,XY Disorder of Sex Development and Variants

Background: The potential involvement of SRY in abnormal gonadal development in 45,X/46,X,der(Y) patients was proposed following the identification of SRY mutations in a few patients with Turner syndrome (TS). However, its exact etiological role in gonadal dysgenesis in patients with Y chromosome mosaicisms has not yet been clarified. Aims: It was the aim of this study to screen for allelic variation in SRY in a large cohort of patients with disorders of sex development due to chromosomal abnormalities with 45, X/46, X, der(Y) karyotype. Patients: Twenty-seven patients, 14 with TS and 13 with mixed gonadal dysgenesis (MGD), harboring 45, X/46, X, der(Y) karyotypes were selected. Methods: Genomic DNA was extracted from peripheral blood leukocytes of all patients and from gonadal tissue in 4 cases. The SRY coding region was PCR amplified and sequenced. Results: We identified only 1 polymorphism (c.561C -> T) in a 45,X/46,XY MGD patient, which was detected in blood and in gonadal tissue. Conclusion: Our results indicate that mutations in SRY are rare findings in patients with Y chromosome mosaicisms. Therefore, a significant role of mutated SRY in the etiology of gonadal dysgenesis in patients harboring 45, X/46, XY karyotype and variants seems very unlikely. Copyright (C) 2010 S. Karger AG, Basel

Absence of GH-Releasing Hormone (GHRH) Mutations in Selected Patients with Isolated GH Deficiency

Context: Although numerous reports of mutations in GH1 and GHRHR (GHRH receptor) causing isolated GH deficiency (IGHD) have been published, mutations in GHRH itself have not been hitherto reported but are obvious candidates for GH deficiency. Objective: The aim of this study was to identify mutations in GHRH in a large cohort of patients with IGHD. Patients and Methods: DNA was isolated from 151 patients diagnosed with IGHD at national and international centers. Seventy-two patients fulfilled all the following criteria: severe short stature (height SD score <= -2.5), low peakGHafter stimulation (peak <= 5 ng/ml), eutopic posterior pituitary lobe, and absence of mutations in GH1 and GHRHR and therefore were strong candidates for GHRH mutations. The coding sequence and splice sites of GHRH were amplified by PCR with intronic primers and sequenced. Results: In five of 151 patients (four of 42 from Brazil), the GHRH c. 223 C>T, p. L75F change was identified in heterozygosity. This variant has been previously reported as a polymorphism and is more frequent in African than European and Asian populations. Six allelic variants (five novel) that do not predict change of amino acids or splice sites were identified in five patients: c. 147 C>T, p.S49S, IVS1 -70 G>A, IVS1 -74 T>C, IVS3 -47 del1, and IVS3 +7 G>A/IVS3 + 41 G>A. No functional mutations were found in this cohort. Conclusions: GHRH mutations were not identified in a selected cohort of patients with IGHD, suggesting that, if they exist, they may be an extremely rare cause of IGHD. Other, as-yet-unidentified genetic factors may be implicated in the genetic etiology of IGHD in our cohort. (J Clin Endocrinol Metab 96: E1457-E1460, 2011)

Loss of heterozygosity of the APC gene in oral squamous cell carcinoma

The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Juvenile onset systemic lupus erythematosus thyroid dysfunction: A subgroup with mild disease?

The aim of this study was to evaluate the frequency of thyroid dysfunction and thyroid antibodies in patients with juvenile onset Systemic Lupus Erythematosus (JOSLE) and its association with clinical and immunological features. Seventy-seven patients with JOSLE, 64 females, median age 19 years, were consecutively enrolled from March to December 2007. Clinical data related to thyroid dysfunction and lupus were obtained by chart review and patient interview. Serum levels of TSH, free T4, anti-thyroglobulin (TgAb), anti-thyroperoxidase (TPOAb), TRAb and lupus related autoantibodies were analyzed by standard techniques. Nine patients were diagnosed as hypothyroidism and 4 hyperthyroidism. 28% JOSLE patients had moderate/high titer of thyroid antibodies: 23% TgAb, 2.6% TPOAb and 3.9% TRAb. JOSLE patients with positive thyroid autoantibodies had higher frequency of anti-U1RNP antibodies than patients without these antibodies (40.9 vs. 14.5%, OR:0.25, CI:0.08-0.76, p = 0.017). Furthermore, renal/neurological/hematological involvement was less frequently observed in patients with hypothyroidism (55.6 vs. 87.5%, OR:0.18, CI:0.04-0.81, p = 0.035) and with thyroid antibodies (68.4 vs. 90.9%, OR:0.22, CI:0.06-0.82. p = 0.027) than in patients without these alterations. No association with PTPN22 polymorphism was found. In conclusion, JOSLE patients have high prevalence of subclinical hypothyroidism. The novel association of anti-thyroid antibodies with anti-U1RNP antibodies in JOSLE seems to identify a subgroup of patients with less life-threatening organ involvement. (C) 2009 Elsevier Ltd. All rights reserved.

Heterozygosity for the S180L Variant of MAL/TIRAP, a Gene Expressing an Adaptor Protein in the Toll-Like Receptor Pathway, Is Associated with Lower Risk of Developing Chronic Chagas Cardiomyopathy

Background. Chagas disease is caused by the protozoan parasite Trypanosoma cruzi. Among T. cruzi-infected individuals, only a subgroup develops severe chronic Chagas cardiomyopathy (CCC); the majority remain asymptomatic. T. cruzi displays numerous ligands for the Toll-like receptors (TLRs), which are an important component of innate immunity that lead to the transcription of proinflammatory cytokines by nuclear factor-kappa B. Because proinflammatory cytokines play an important role in CCC, we hypothesized that single-nucleotide polymorphisms (SNPs) in the genes that encode proteins in the TLR pathway could explain differential susceptibility to CCC among T. cruzi-infected individuals. Methods. For 169 patients with CCC and 76 T. cruzi-infected, asymptomatic individuals, we analyzed SNPs by use of polymerase chain reaction-restriction fragment length polymorphism analysis for the genes TLR1, TLR2, TLR4, TLR5, TLR9, and MAL/TIRAP, which encodes an adaptor protein. Results. Heterozygous carriers of the MAL/TIRAP variant S180L were more prevalent in the asymptomatic group (24 [32%] of 76 subjects) than in the CCC group (21 [12%] of 169) (chi(2) = 12.6; P = .0004 [adjusted P (P(c)) = .0084]; odds ratio [OR], 0.31 [95% confidence interval {CI}, 0.16-0.60]). Subgroup analysis showed a stronger association when asymptomatic patients were compared with patients who had severe CCC (i.e., patients with left-ventricular ejection fraction <= 40%) (chi(2) = 11.3; P = .0008 [P(c) = .017]; OR, 0.22 [95% CI, 0.09-0.56]) than when asymptomatic patients were compared with patients who had mild CCC (i.e., patients with left-ventricular ejection fraction >40%) (chi(2) = 7.7; P = .005 [P(c) = .11]; OR, 0.33 [95% CI, 0.15-0.73]). Conclusion. T. cruzi-infected individuals who are heterozygous for the MAL/TIRAP S180L variant that leads to a decrease in signal transduction upon ligation of TLR2 or TLR4 to their respective ligand may have a lower risk of developing CCC.

Sertraline vs. ELectrical Current Therapy for Treating Depression Clinical Trial - SELECT TDCS: Design, rationale and objectives

Background: Despite significant advancements in psychopharmacology, treating major depressive disorder (MDD) is still a challenge considering the efficacy, tolerability, safety, and economical costs of most antidepressant drugs. One approach that has been increasingly investigated is modulation of cortical activity with tools of non-invasive brain stimulation - such as transcranial magnetic stimulation and transcranial direct current stimulation (tDCS). Due to its profile, tDCS seems to be a safe and affordable approach. Methods and design: The SELECT TDCS trial aims to compare sertraline vs. tDCS in a double-blinded, randomized, factorial trial enrolling 120 participants to be allocated to four groups to receive sertraline + tDCS, sertraline, tDCS or placebo. Eligibility criteria are moderate-to-severe unipolar depression (Hamilton Depression Rating Scale >17) not currently on sertraline treatment. Treatment will last 6 weeks and the primary outcome is depression change in the Montgomery-Asberg Depression Rating Score (MADRS). Potential biological markers that mediate response, such as BDNF serum levels, Val66Met BDNF polymorphism, and heart rate variability will also be examined. A neuropsychological battery with a focus on executive functioning will be administered. Discussion: With this design we will be able to investigate whether tDCS is more effective than placebo in a sample of patients free of antidepressants and in addition, we will be able to secondarily compare the effect sizes of sertraline vs. tDCS and also the comparison between tDCS and combination of tDCS and sertraline. (C) 2010 Elsevier Inc. All rights reserved.

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

Rheumatic Fever and Rheumatic Heart Disease: Cellular Mechanisms Leading Autoimmune Reactivity and Disease

Rheumatic fever (RF) is an autoimmune disease caused by the gram-positive bacteria Streptococcus pyogenes that follows a nontreated throat infection in susceptible children. The disease manifests as polyarthritis, carditis, chorea, erythema marginatum, and/or subcutaneous nodules. Carditis, the most serious complication, occurs in 30% to 45% of RF patients and leads to chronic rheumatic heart disease (RHD), which is characterized by progressive and permanent valvular lesions. In this review, we will focus on the genes that confer susceptibility for developing the disease, as well as the innate and adaptive immune responses against S. pyogenes during the acute rheumatic fever episode that leads to RHD autoimmune reactions. The disease is genetically determined, and some human leukocyte antigen class II alleles are involved with susceptibility. Other single nucleotide polymorphisms for TNF-alpha and mannan-binding lectin genes were reported as associated with RF/RHD. T cells play an important role in RHD heart lesions. Several autoantigens were already identified, including cardiac myosin epitopes, vimentin, and other intracellular proteins. In the heart tissue, antigen-driven oligoclonal T cell expansions were probably the effectors of the rheumatic heart lesions. These cells are CD4(+) and produced inflammatory cytokines (TNF alpha and IFN gamma). Molecular mimicry is the mechanism that mediated the cross-reactions between streptococcal antigens and human proteins. The elucidation of chemokines and their receptors involved with the recruitment of Th1, Th2, and Th17 cells, as well as the function of T regulatory cells in situ will certainly contribute to the delineation of the real picture of the heart lesion process that leads to RHD.

Meta-analysis of the association of 4 angiotensinogen polymorphisms with essential hypertension - A role beyond M235T?

Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.

Characterization of high density lipoprotein particles in familial apolipoprotein A-I deficiency

Our aim was to characterize HDL subspecies and fat-soluble vitamin levels in a kindred with familial apolipoprotein A-I (apoA-I) deficiency. Sequencing of the APOA1 gene revealed a nonsense mutation at codon 22, Q[22] X, with two documented homozygotes, eight heterozygotes, and two normal subjects in the kindred. Homozygotes presented markedly decreased HDL cholesterol levels, undetectable plasma apoA-1, tuboeruptive and planar xanthomas, mild corneal arcus and opacification, and severe premature coronary artery disease. In both homozygotes, analysis of HDL particles by two-dimensional gel electrophoresis revealed undetectable apoA-I, decreased amounts of small a-3 migrating apoA-II particles, and only modestly decreased normal amounts of slow a migrating apoA-IV- and apoE-containing HDL, while in the eight heterozygotes, there was loss of large alpha-1 HDL particles. There were no significant decreases in plasma fat-soluble vitamin levels noted in either homozygotes or heterozygotes compared with normal control subjects. Our data indicate that isolated apoA-I deficiency results in marked HDL deficiency with very low apoA-II alpha-3 HDL particles, modest reductions in the separate and distinct plasma apoA-IV and apoE HDL particles, tuboeruptive xanthomas, premature coronary atherosclerosis, and no evidence of fat malabsorption.