958 resultados para Two stages
Resumo:
To compare the hemodynamic changes following two different lipid emulsion therapies after bupivacaine intoxication in swines. Large White pigs were anesthetized with thiopental, tracheal intubation performed and mechanical ventilation instituted. Hemodynamic variables were recorded with invasive pressure monitoring and pulmonary artery catheterization (Swan-Ganz catheter). After a 30-minute resting period, 5 mg.kg-1 of bupivacaine by intravenous injection was administered and new hemodynamic measures were performed 1 minute later; the animals were than randomly divided into three groups and received 4 ml.kg-1 of one of the two different lipid emulsion with standard long-chaim triglyceride, or mixture of long and medium-chain triglyceride, or saline solution. Hemodynamic changes were then re-evaluated at 5, 10, 15, 20 and 30 minutes. Bupivacaine intoxication caused fall in arterial blood pressure, cardiac index, ventricular systolic work index mainly and no important changes in vascular resistances. Both emulsion improved arterial blood pressure mainly increasing vascular resistance since the cardiac index had no significant improvement. On the systemic circulation the hemodynamic results were similar with both lipid emulsions. Both lipid emulsions were efficient and similar options to reverse hypotension in cases of bupivacaine toxicity.
Resumo:
The syndrome of resistance to thyroid hormone (RTH β) is an inherited disorder characterized by variable tissue hyposensitivity to 3,5,30-l-triiodothyronine (T3), with persistent elevation of free-circulating T3 (FT3) and free thyroxine (FT4) levels in association with nonsuppressed serum thyrotropin (TSH). Clinical presentation is variable and the molecular analysis of THRB gene provides a short cut diagnosis. Here, we describe 2 cases in which RTH β was suspected on the basis of laboratory findings. The diagnosis was confirmed by direct THRB sequencing that revealed 2 novel mutations: the heterozygous p.Ala317Ser in subject 1 and the heterozygous p.Arg438Pro in subject 2. Both mutations were shown to be deleterious by SIFT, PolyPhen, and Align GV-GD predictive methods.
Resumo:
To evaluate pathologic features with implications on surgical radicality in women treated with radical hysterectomy and pelvic lymphadenectomy for cervical cancer stage IA1 with lymph vascular space invasion (LVSI) and stage IA2 by correlating findings in conization and hysterectomy specimens. Women with cervical cancer stage IA1 with LVSI and stage IA2 diagnosed by loop electrosurgical excisional procedure or cold knife conization were treated with radical hysterectomy and pelvic lymphadenectomy from January 1999 to December 2011 in 2 institutions. Fifty patients were enrolled: 40 with stage IA2 and 10 with stage IA1 with LVSI. Median age was 43 (30-67) years. All patients underwent cervical conization for diagnosis (45 loop electrosurgical excisional procedure, 5 cold knife). Lymph vascular space invasion was detected in 15 patients (30%). Two patients had positive pelvic nodes. No parametrial involvement was detected in the entire cohort. Positive margins were present in 35 patients, and residual disease was detected in 22 patients (44%). Positive margins predicted residual disease at radical hysterectomy (P = 0.02). Medium follow-up time was 51 months. One patient developed a pelvic recurrence, and there were no disease-related deaths. Patients with positive margins in cone biopsy specimens have an increased risk of residual disease at radical hysterectomy and require careful evaluation before conservative surgery. Pelvic lymph node evaluation is essential because lymph node metastasis may occur even in early stages. The lack of parametrial invasion in this study reinforces the knowledge that the select group of patients with microinvasive cervical carcinoma stages IA1 LVSI and stage IA2 have a very low risk of parametrial infiltration. Less radical surgery can be carefully considered for these patients.
Resumo:
In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.
Resumo:
Different storage conditions can induce changes in the colour and carotenoid profiles and levels in some fruits. The goal of this work was to evaluate the influence of low temperature storage on the colour and carotenoid synthesis in two banana cultivars: Prata and Nanicão. For this purpose, the carotenoids from the banana pulp were determined by HPLC-DAD-MS/MS, and the colour of the banana skin was determined by a colorimeter method. Ten carotenoids were identified, of which the major carotenoids were all-trans-lutein, all-trans-α-carotene and all-trans-β-carotene in both cultivars. The effect of the low temperatures was subjected to linear regression analysis. In cv. Prata, all-trans-α-carotene and all-trans-β-carotene were significantly affected by low temperature (p<0.01), with negative estimated values (β coefficients) indicating that during cold storage conditions, the concentrations of these carotenoids tended to decrease. In cv. Nanicão, no carotenoid was significantly affected by cold storage (p>0.05). The accumulation of carotenoids in this group may be because the metabolic pathways using these carotenoids were affected by storage at low temperatures. The colour of the fruits was not negatively affected by the low temperatures (p>0.05).
Saphenous vein graft bypass in the treatment of giant cavernous sinus aneurysms: report of two cases
Resumo:
Two cases of giant intracavernous aneurysms treated by high flow bypass with saphenous vein graft between the external carotid artery (ECA) and branches of the middle cerebral artery (MCA) are presented. Very often these aneurysms are unclippable because they are fusiform or have a large neck. Occlusion of the internal carotid artery (ICA) is the treatment of choice in many cases. This procedure has however a high risk of brain infarction. Revascularization of the brain by extra-intracranial anastomosis between the superficial temporal artery (STA) and branches of the MCA is frequently performed. This procedure provides however a low flow bypass and brain infarction may occur. We report two cases of giant cavernous sinus aneurysms treated by high flow bypass and endovascular balloon occlusion of the ICA. Immediate high flow revascularization of MCA branches was achieved and the patients showed no ischemic events. Follow-up of 8 and 14 months after operation shows patency of the venous graft and no neurological deficits. Angiographic control examination showed complete aneurysm occlusion in both cases.
Resumo:
This study evaluated two cases of Apert's syndrome, through phonological, cognitive, and neuropsychological instruments and correlated the results to complementary exams. In short, this study reveals the necessity of application of neuropsychological, cognitive and phonological evaluation and correlation of the results with complementary testings because significant differences can be present in the Apert's syndrome.
Resumo:
We report on two epileptic patients who developed acute psychosis after the use of topiramate (TPM). One patient exhibited severe psychomotor agitation, heteroaggressiveness, auditory and visual hallucinations as well as severe paranoid and mystic delusions. The other patient had psychomotor agitation, depersonalization, derealization, severe anxiety and deluded that he was losing his memory. Both patients had to be taken to the casualty room. After interruption of TPM in one patient and reduction of dose in the other, a full remission of the psychotic symptoms was obtained without the need of antipsychotic drugs. Clinicians should be aware of the possibility of development of acute psychotic symptoms in patients undergoing TPM treatment.
Resumo:
Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Increasing water scarcity and depleted water productivity in irrigated soils are inducing farmers to adopt improved varieties, such as those with high-capacity tolerance. The use of tolerant varieties of sugarcane might substantially avoid the decline of productivity under water deficit. This research aimed to evaluate the harmful effects of drought on the physiology of two sugarcane varieties (RB867515 and RB962962) during the initial development. Young plants were subjected to irrigation suspension until total stomata closure, and then rewatered. Significant reduction on stomatal conductance, transpiration, and net photosynthesis were observed. RB867515 showed a faster stomatal closure while RB962962 slowed the effects of drought on the gas exchanges parameters with a faster recovering after rewatering. Accumulation of carbohydrates, amino acids, proline, and protein in the leaves and roots of the stressed plants occurred in both varieties, substantially linked to reduction of the leaf water potential. Due to the severity of stress, this accumulation was not enough to maintain the cell turgor pressure, so relative water content was diminished. Water stress affected the contents of chlorophyll (a, b, and total) in both varieties, but not the levels of carotenoids. There was a significant reduction in dry matter under stress. In conclusion, RB962962 variety endured stressed conditions more than RB867515, since it slowed down the damaging effects of drought on the gas exchanges. In addition, RB962962 presented a faster recovery than RB867515, a feature that qualifies it as a variety capable of enduring short periods of drought without major losses in the initial stage of its development.
Resumo:
The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.
Resumo:
X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física