Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Utilização dos testes de função tireoidiana na prática clínica

Laboratory tests are essential for accurate diagnosis and cost-effective management of thyroid disorders. When the clinical suspicion is strong, hormonal levels just confirms the diagnosis. However, in most patients, symptoms are subtle and unspecific, so that only biochemical tests can detect the disorder. The objective of this article is to do a critical analysis of the appropriate use of the most important thyroid function tests, including serum concentrations of thyrotropin (TSH), thyroid hormones and antithyroid antibodies. Through a survey in the MedLine database, we discuss the major pitfalls and interferences related to daily use of these tests and recommendations are presented to optimize the use of these diagnostic tools in clinical practice.

O aluno portador de visão subnormal na escola regular: desafio para o professor?

Purpose:1) To check self-knowledge and needs for orientation among regular class teachers working with low vision students; 2) To gather information to assist the training on visual deficiency of regular class teachers. Methods: A survey was conducted for the academic year of 1999 among those teachers working in public schools, Campinas/SP/Brazil, of which 11 were municipal and 9 state schools, respectively 79.0% and 90.0% of these schools. A self-administered questionnaire was used as data collection instrument. Results: The sample was composed of 50 teachers with a regular class experience averaging 20 years. Most of them, 94.0%, said that they had no specific preparation in the area of low vision. Only 18 teachers declared to have received some kind of information/orientation in order to work with their low vision students and of those only 15 teachers mentioned the kind of orientation received. The whole group of 50 declared interest in receiving information. From the information/orientation requested 66.0% mentioned extended working class materials, 50.0% visual performance and eye disease of their students and 46.0% visual acuity/visual field. Conclusion: It was detected that teachers of regular classes received none or little information about their low vision students but demonstrated interest in its obtention. It was also shown that those teachers are not prepared to work with visually impaired children.

Crescimento fisico em crianças e adolescentes de moderada altitude

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física

A educação física na educação infantil e as relações de gênero : educando crianças ou meninos e meninas?

Universidade Estadual de Campinas . Faculdade de Educação Física

Aspectos da educação do corpo no curriculo de pedagogia

Universidade Estadual de Campinas . Faculdade de Educação Física

Medida da capacidade antioxidante de fluidos biologicos por voltametria de pulso diferencial associada ao uso de surfactante como resposta as adaptações geradas pelo exercicio

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito de onze semanas de treinamento sobre a velocidade critica e o limiar anaerobio em nadadores

Universidade Estadual de Campinas . Faculdade de Educação Física

Barreiras socio-culturais e lazer das pessoas portadoras de deficiencia fisica : um estudo do grupo Fraternidade Cristã de Doença e Deficiencia de Campinas, SP

Universidade Estadual de Campinas. Faculdade de Educação Física

A ginastica como area de conhecimento na formação profissional em educação fisica : encaminhamentos para uma reestruturação curricular

Universidade Estadual de Campinas . Faculdade de Educação Física

Formação continuada de professores de educação fisica em ambiente escolar inclusivo

Universidade Estadual de Campinas. Faculdade de Educação Física

Análise do perfil de humor e da enzima alfa-amilase salivar em indivíduos fisicamente ativos = : Analysis of profile of mood states and salivary alpha amylase enzyme in physically active individuals

Universidade Estadual de Campinas . Faculdade de Educação Física

Percepção de esforço em exercício sob fadiga em normóxia e hipóxia

Universidade Estadual de Campinas . Faculdade de Educação Física