Genomic organization, complex splicing pattern and expression of a human septin gene on chromosome 17q25.3

The Ov/Br septin gene, which is also a fusion partner of MLL in acute myeloid leukaemia, is a member of a family of novel GTP binding proteins that have been implicated in cytokinesis and exocytosis. In this study, we describe the genomic and transcriptional organization of this gene, detailing seventeen exons distributed over 240 kb of sequence. Extensive database analyses identified orthologous rodent cDNAs that corresponded to new, unidentified 5' splice variants of the Ov/Br septin gene, increasing the total number of such variants to six. We report that splicing events, occurring at non-canonical sites within the body of the 3' terminal exon, remove either 1801 bp or 1849 bp of non-coding sequence and facilitate access to a secondary open reading frame of 44 amino acids maintained near the end of the 3' UTR. These events constitute a novel coding arrangement and represent the first report of such a design being implemented by a eukaryotic gene. The various Ov/Br proteins either differ minimally at their amino and carboxy termini or are equivalent to truncated versions of larger isoforms. Northern analysis with an Ov/Br septin 3' UTR probe reveals three transcripts of 4.4, 4 and 3 kb, the latter being restricted to a sub-set of the tissues tested. Investigation of the identified Ov/Br septin isoforms by RT-PCR confirms a complex transcriptional pattern, with several isoforms showing tissue-specific distribution. To date, none of the other human septins have demonstrated such transcriptional complexity.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Functional comparison of the endothelial nitric oxide synthase Glu298Asp polymorphic variants in human endothelial cells

The G894T endothelial nitric oxide synthase (eNOS) polymorphism results in a Glu to Asp substitution at position 298. This position is located externally on the protein and as the regulation of eNOS is dependent on its subcellular localization and interaction with modulatory proteins, we aimed to address whether the substitution of Asp at 298 had any effect on these mechanisms. Initially, we developed a novel method to accurately determine molar quantities of each variant by expressing them as green fluorescent protein (GFP) fusion proteins and using recombinant adenoviruses to facilitate transient infection of human microvascular endothelial cells. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting of eNOS298Asp revealed a 135-kDa proteolytic fragment which was not present with eNOS298Glu. This proteolysis was prevented by using LDS buffer confirming that this differential cleavage is an artefact of sample preparation and unlikely to occur intracellularly. Nitric oxide was measured following stimulation with calcium ionophore or oestrogen in the presence of varying sepiapterin concentrations. GFP fluorescence was used to quantify the amount of fusion protein and calculate intracellular specific activity. There was no significant difference in intracellular specific activity between Glu298 and Asp298 eNOS in response to calcium ionophore or oestrogen. Tetrahydrobiopterin supplementation increased eNOS activity of both variants in an identical manner. The presence of the GFP also facilitated the visualization of the variants by confocal microscopy and demonstrated that both localized to the plasma membrane and the Golgi. These findings demonstrate that the Asp substitution at 298 does not have a major effect in modulating eNOS activity in vivo.

The Septin-Binding Protein Anillin is Over-Expressed in Diverse Human Tumours

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

Effect of a COL1A1 Sp1 Binding Site Polymorphism on Arterial Pulse Wave Velocity: An Index of Compliance.

Reduced arterial compliance precedes changes in blood pressure, which may be mediated through alterations in vessel wall matrix composition. We investigated the effect of the collagen type I-1 gene (COL1A1) +2046G>T polymorphism on arterial compliance in healthy individuals. We recruited 489 subjects (251 men and 238 women; mean age, 22.6±1.6 years). COL1A1 genotypes were determined using polymerase chain reaction and digestion by restriction enzyme Bal1. Arterial pulse wave velocities were measured in 3 segments, aortoiliac (PWVA), aortoradial (PWVB), and aorto-dorsalis-pedis (PWVF), as an index of compliance using a noninvasive optical method. Data were available for 455 subjects. The sample was in Hardy-Weinberg equilibrium with genotype distributions and allele frequencies that were not significantly different from those reported previously. The T allele frequency was 0.22 (95% confidence interval, 0.19 to 0.24). Two hundred eighty-three (62.2%) subjects were genotype GG, 148 (35.5%) subjects were genotype GT, and 24 (5.3%) subjects were genotype TT. A comparison of GG homozygotes with GT and TT individuals demonstrated a statistically significant association with arterial compliance: PWVF 4.92±0.03 versus 5.06±0.05 m/s (ANOVA, P=0.009), PWVB 4.20±0.03 versus 4.32±0.04 m/s (ANOVA, P=0.036), and PWVA 3.07±0.03 versus 3.15±0.03 m/s (ANOVA, P=0.045). The effects of genotype were independent of age, gender, smoking, mean arterial pressure, body mass index, family history of hypertension, and activity scores. We report an association between the COL1A1 gene polymorphism and arterial compliance. Alterations in arterial collagen type 1A deposition may play a role in the regulation of arterial compliance

Assocation Between Variation in the Actin-Binding Gene Caldesmon and Diabetic Nephropathy in Type 1 Diabetes

Dysfunction of the actin cytoskeleton is a key event in the pathogenesis of diabetic nephropathy. We previously reported that certain cytoskeletal genes are upregulated in mesangial cells exposed to a high extracellular glucose concentration. One such gene, caldesmon, lies on chromosome 7q35, a region linked to nephropathy in family studies, making it a candidate susceptibility gene for diabetic nephropathy. We screened all exons, untranslated regions, and a 5-kb region upstream of the gene for variation using denaturing high-performance liquid chromatography technology. An A>G single nucleotide polymorphism (SNP) at position -579 in the promoter region was associated with nephropathy in a case-control study using 393 type 1 diabetic patients from Northern Ireland (odds ratio [OR] 1.38, 95% CI 1.02–1.86, P = 0.03). A similar trend was found in an independent sample from a second center. When the sample groups were combined (n = 606), the association between the -579G allele and nephropathy remained significant (OR 1.35, 1.07–1.70, P = 0.01). The haplotype structure in the surrounding 7-kb region was determined. No single haplotype was more strongly associated with nephropathy than the -579A>G SNP. These results suggest a role for the caldesmon gene in susceptibility to diabetic nephropathy in type 1 diabetes.

Relevance of heterometallic binding energy for metal underpotential deposition

We present first-principles calculations for a number of metals adsorbed on several different metallic substrates. Some of these systems are very relevant in electrochemistry, especially in the field of underpotential deposition phenomena. The present studies reveal the existence of a relationship between the excess binding energy and the surface energy difference between substrate and adsorbate. Comparisons with experimental underpotential shifts show that excess binding energies are systematically underestimated. By analyzing experimental information on different systems, we conclude that this discrepancy between our vacuum calculations and experiments carried out in an electrolytic solution is likely to be due to anion adsorption and/or solvent effects.

Tight-binding simulation of current-carrying nanostructures

The tight-binding (TB) approach to the modelling of electrical conduction in small structures is introduced. Different equivalent forms of the TB expression for the electrical current in a nanoscale junction are derived. The use of the formalism to calculate the current density and local potential is illustrated by model examples. A first-principles time-dependent TB formalism for calculating current-induced forces and the dynamical response of atoms is presented. An earlier expression for current-induced forces under steady-state conditions is generalized beyond local charge neutrality and beyond orthogonal TB. Future directions in the modelling of power dissipation and local heating in nanoscale conductors are discussed.