Molecular genetic analysis of DNA alterations in Irish colorectal cancer

Colorectal cancer is the most common cause of death due to malignancy in nonsmokers in the western world. In 1995 there were 1,757 cases of colon cancer in Ireland. Most colon cancer is sporadic, however ten percent of cases occur where there is a previous family history of the disease. In an attempt to understand the tumorigenic pathway in Irish colon cancer patients, a number of genes associated with colorectal cancer development were analysed in Irish sporadic and HNPCC colon cancer patients. The hereditary forms of colon cancer include Familial adenomatous polyposis coli (FAP) and Hereditary Non-Polyposis Colon Cancer (HNPCC). Genetic analysis of the gene responsible for FAP, (the APC gene) has been previously performed on Irish families, however the genetic analysis of HNPCC families is limited. In an attempt to determine the mutation spectrum in Irish HNPCC pedigrees, the hMSH2 and hMLHl mismatch repair genes were screened in 18 Irish HNPCC families. Using SSCP analysis followed by DNA sequencing, five mutations were identified, four novel and a previously reported mutation. In families where a mutation was detected, younger asyptomatic members were screened for the presence of the predisposing mutation (where possible). Detection of mutations is particularly important for the identification of at risk individuals as the early diagnosis of cancer can vastly improve the prognosis. The sensitive and efficient detection of multiple different mutations and polymorphisms in DNA is of prime importance for genetic diagnosis and the identification of disease genes. A novel mutation detection technique has recently been developed in our laboratory. In order to assess the efficacy and application of the methodology in the analysis of cancer associated genes, a protocol for the analysis of the K-ras gene was developed and optimised. Matched normal and tumour DNA from twenty sporadic colon cancer patients was analysed for K-ras mutations using the Glycosylase Mediated Polymorphism Detection technique. Five mutations of the K-ras gene were detected using this technology. Sequencing analysis verified the presence of the mutations and SSCP analysis of the same samples did not identify any additional mutations. The GMPD technology proved to be highly sensitive, accurate and efficient in the identification of K-ras gene mutations. In order to investigate the role of the replication error phenomenon in Irish colon cancer, 3 polyA tract repeat loci were analysed. The repeat loci included a 10 bp intragenic repeat of the TGF-β-RII gene. TGF-β-RII is involved in the TGF-β epithelial cell growth pathway and mutation of the gene is thought to play a role in cell proliferation and tumorigenesis. Due to the presence of a repeat sequence within the gene, TGFB-RII defects are associated with tumours that display the replication error phenomenon. Analysis of the TGF-β-RII 10 bp repeat failed to identify mutations in any colon cancer patients. Analysis of the Bat26 and Bat 40 polyA repeat sequences in the sporadic and HNPCC families revealed that instability is associated with HNPCC tumours harbouring mismatch repair defects and with 20 % of sporadic colon cancer tumours. No correlation between K-ras gene mutations and the RER+ phenotype was detected in sporadic colon cancer tumours.

In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate.

Thermoplastic materials such as cyclic-olefin copolymers (COC) provide a versatile and cost-effective alternative to the traditional glass or silicon substrate for rapid prototyping and industrial scale fabrication of microdevices. To extend the utility of COC as an effective microarray substrate, we developed a new method that enabled for the first time in situ synthesis of DNA oligonucleotide microarrays on the COC substrate. To achieve high-quality DNA synthesis, a SiO(2) thin film array was prepatterned on the inert and hydrophobic COC surface using RF sputtering technique. The subsequent in situ DNA synthesis was confined to the surface of the prepatterned hydrophilic SiO(2) thin film features by precision delivery of the phosphoramidite chemistry using an inkjet DNA synthesizer. The in situ SiO(2)-COC DNA microarray demonstrated superior quality and stability in hybridization assays and thermal cycling reactions. Furthermore, we demonstrate that pools of high-quality mixed-oligos could be cleaved off the SiO(2)-COC microarrays and used directly for construction of DNA origami nanostructures. It is believed that this method will not only enable synthesis of high-quality and low-cost COC DNA microarrays but also provide a basis for further development of integrated microfluidics microarrays for a broad range of bioanalytical and biofabrication applications.

Binding of MetJ repressor to specific and nonspecific DNA and effect of S-adenosylmethionine on these interactions.

We have used analytical ultracentrifugation to characterize the binding of the methionine repressor protein, MetJ, to synthetic oligonucleotides containing zero to five specific recognition sites, called metboxes. For all lengths of DNA studied, MetJ binds more tightly to repeats of the consensus sequence than to naturally occurring metboxes, which exhibit a variable number of deviations from the consensus. Strong cooperative binding occurs only in the presence of two or more tandem metboxes, which facilitate protein-protein contacts between adjacent MetJ dimers, but weak affinity is detected even with DNA containing zero or one metbox. The affinity of MetJ for all of the DNA sequences studied is enhanced by the addition of SAM, the known cofactor for MetJ in the cell. This effect extends to oligos containing zero or one metbox, both of which bind two MetJ dimers. In the presence of a large excess concentration of metbox DNA, the effect of cooperativity is to favor populations of DNA oligos bound by two or more MetJ dimers rather than a stochastic redistribution of the repressor onto all available metboxes. These results illustrate the dynamic range of binding affinity and repressor assembly that MetJ can exhibit with DNA and the effect of the corepressor SAM on binding to both specific and nonspecific DNA.

Intergenic and genic sequence lengths have opposite relationships with respect to gene expression.

Eukaryotic genomes are mostly composed of noncoding DNA whose role is still poorly understood. Studies in several organisms have shown correlations between the length of the intergenic and genic sequences of a gene and the expression of its corresponding mRNA transcript. Some studies have found a positive relationship between intergenic sequence length and expression diversity between tissues, and concluded that genes under greater regulatory control require more regulatory information in their intergenic sequences. Other reports found a negative relationship between expression level and gene length and the interpretation was that there is selection pressure for highly expressed genes to remain small. However, a correlation between gene sequence length and expression diversity, opposite to that observed for intergenic sequences, has also been reported, and to date there is no testable explanation for this observation. To shed light on these varied and sometimes conflicting results, we performed a thorough study of the relationships between sequence length and gene expression using cell-type (tissue) specific microarray data in Arabidopsis thaliana. We measured median gene expression across tissues (expression level), expression variability between tissues (expression pattern uniformity), and expression variability between replicates (expression noise). We found that intergenic (upstream and downstream) and genic (coding and noncoding) sequences have generally opposite relationships with respect to expression, whether it is tissue variability, median, or expression noise. To explain these results we propose a model, in which the lengths of the intergenic and genic sequences have opposite effects on the ability of the transcribed region of the gene to be epigenetically regulated for differential expression. These findings could shed light on the role and influence of noncoding sequences on gene expression.

Interactions of chromatin context, binding site sequence content, and sequence evolution in stress-induced p53 occupancy and transactivation.

Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, gene expression, H3K4me3, chromatin accessibility (DNase 1 hypersensitivity, DHS), ENCODE chromatin states, p53RE sequence, and evolutionary conservation. We observed that the inducible expression of p53-regulated genes was associated with the steady-state chromatin status of the cell. Most highly inducible p53-regulated genes were suppressed at baseline and marked by repressive histone modifications or displayed CTCF binding. Comparison of p53RE sequences residing in different chromatin contexts demonstrated that weaker p53REs resided in open promoters, while stronger p53REs were located within enhancers and repressed chromatin. p53 occupancy was strongly correlated with similarity of the target DNA sequences to the p53RE consensus, but surprisingly, inversely correlated with pre-existing nucleosome accessibility (DHS) and evolutionary conservation at the p53RE. Occupancy by p53 of REs that overlapped transposable element (TE) repeats was significantly higher (p<10-7) and correlated with stronger p53RE sequences (p<10-110) relative to nonTE-associated p53REs, particularly for MLT1H, LTR10B, and Mer61 TEs. However, binding at these elements was generally not associated with transactivation of adjacent genes. Occupied p53REs located in L2-like TEs were unique in displaying highly negative PhyloP scores (predicted fast-evolving) and being associated with altered H3K4me3 and DHS levels. These results underscore the systematic interaction between chromatin status and p53RE context in the induced transactivation response. This p53 regulated response appears to have been tuned via evolutionary processes that may have led to repression and/or utilization of p53REs originating from primate-specific transposon elements.

Explicit DNase sequence bias modeling enables high-resolution transcription factor footprint detection.

DNaseI footprinting is an established assay for identifying transcription factor (TF)-DNA interactions with single base pair resolution. High-throughput DNase-seq assays have recently been used to detect in vivo DNase footprints across the genome. Multiple computational approaches have been developed to identify DNase-seq footprints as predictors of TF binding. However, recent studies have pointed to a substantial cleavage bias of DNase and its negative impact on predictive performance of footprinting. To assess the potential for using DNase-seq to identify individual binding sites, we performed DNase-seq on deproteinized genomic DNA and determined sequence cleavage bias. This allowed us to build bias corrected and TF-specific footprint models. The predictive performance of these models demonstrated that predicted footprints corresponded to high-confidence TF-DNA interactions. DNase-seq footprints were absent under a fraction of ChIP-seq peaks, which we show to be indicative of weaker binding, indirect TF-DNA interactions or possible ChIP artifacts. The modeling approach was also able to detect variation in the consensus motifs that TFs bind to. Finally, cell type specific footprints were detected within DNase hypersensitive sites that are present in multiple cell types, further supporting that footprints can identify changes in TF binding that are not detectable using other strategies.

Regulation of the alpha-fetoprotein promoter: Ku binding and DNA spatial conformation

This work shows that the proximal promoter of the mouse Afp gene contains a Ku binding site and that Ku binding is associated with down-regulation of the transcriptional activity of the Afp promoter. The Ku binding site is located in a segment able to adopt a peculiar structured form, probably a hairpin structure. Interestingly, the structured form eliminates the binding sites of the positive transcription factor HNF1. Furthermore, a DNAse hypersensitive site is detected in footprinting experiments done with extracts of AFP non-expressing hepatoma cells. These observations suggest that the structured form is stabilised by Ku and is associated with extinction of the gene in AFP non-expressing hepatic cells.

Synthesis of N3- and 2-NH2-substituted 6,7-diphenylpterins and their use as intermediates for the preparation of oligonucleotide conjugates designed to target photooxidative damage on single-stranded DNA representing the bcr-abl chimeric gene

Two 17-mer oligodeoxynucleotide-5'-linked-(6,7-diphenylpterin) conjugates, 2 and 3, were prepared as photosensitisers for targeting photooxidative damage to a 34-mer DNA oligodeoxynucleotide (ODN) fragment 1 representing the chimeric bcr-abl gene that is implicated in the pathogenesis of chronic myeloid leukaemia (CML). The base sequence in the 17-mer was 3'G G T A G T T A T T C C T T C T T5'. In the first of these ODN conjugates (2) the pterin was attached at its N3 atom, via a -(CH2)3OPO(OH)- linker, to the 5'-OH group of the ODN. Conjugate 2 was prepared from 2-amino-3-(3-hydroxypropyl)-6,7-diphenyl-4(3H)-pteridinone 10, using phosphoramidite methodology. Starting material 10 was prepared from 5-amino-7-methylthiofurazano[3,4-d]pyrimidine 4 via an unusual highly resonance stabilised cation 8, incorporating the rare 2H,6H-pyrimido[6,1-b][1,3]oxazine ring system. In the characterisation of 10 two pteridine phosphazenes, 15 and 29, were obtained, as well as new products containing two uncommon tricyclic ring systems, namely pyrimido[2,1-b]pteridine (20 and 24) and pyrimido[1,2-c]pteridine (27). In the second ODN conjugate the linker was -(CH2)5CONH(CH2)6OPO(OH)- and was attached to the 2-amino group of the pterin. In the preparation of 3, the N-hydroxysuccinimide ester 37 of 2-(5-carboxypentylamino)-6,7-diphenyl-4(3H)-pteridinone was condensed with the hexylamino-modified 17-mer. Excitation of 36 with near UV light in the presence of the single-stranded target 34-mer, 5'T G A C C A T C A A T A A G14 G A A G18 A A G21 C C C T T C A G C G G C C3' 1 caused oxidative damage at guanine bases, leading to alkali-labile sites which were monitored by polyacrylamide gel electrophoresis. Cleavage was observed at all guanine sites with a marked preference for cleavage at G14. In contrast, excitation of ODN-pteridine conjugate 2 in the presence of 1 caused oxidation of the latter predominantly at G18, with a smaller extent of cleavage at G15 and G14 (in the double-stranded portion) and G21. These results contrast with our previous observation of specific cleavage at G21 with ruthenium polypyridyl sensitisers, and suggest that a different mechanism, probably one involving Type 1 photochemical electron transfer, is operative. Much lower yields were found with the ODN-pteridine conjugate 3, perhaps as a consequence of the longer linker between the ODN and the pteridine in this case.

Metastasis-inducing DNA Regulates the Expression of the Osteopontin Gene by Binding the Transcription Factor Tcf-4

Small 1,000-bp fragments of genomic DNA obtained from human malignant breast cancer cell lines when transfected into a benign rat mammary cell line enhance transcription of the osteopontin gene and thereby cause the cells to metastasize in syngeneic rats. To identify the molecular events underlying this process, transient cotransfections of an osteopontin promoter-reporter construct and fragments of one metastasis-inducing DNA (Met-DNA) have identified the active components in the Met-DNA as the binding sites for the T-cell factor (Tcf) family of transcription factors. Incubation of cell extracts with active DNA fragments containing the sequence CAAAG caused retardation of their mobilities on polyacrylamide gels, and Western blotting identified Tcf-4, beta-catenin, and E-cadherin in the relevant DNA complexes in vitro. Transfection of an expression vector for Tcf-4 inhibited the stimulated activity of the osteopontin promoter-reporter construct caused by transiently transfected active fragments of Met-DNA or permanently transfected Met-DNA. This stimulated activity of the osteopontin promoter-reporter construct is accompanied by an increase in endogenous osteopontin mRNA but not in fos or actin mRNAs in the transfected cells. Permanent transfection of the benign rat mammary cell line with a 20-bp fragment from the Met-DNA containing the Tcf recognition sequence CAAAG caused an enhanced permanent production of endogenous osteopontin protein in vitro and induced the cells to metastasize in syngeneic rats in vivo. The corresponding fragment without the CAAAG sequence was without either effect. Therefore, the regulatory effect of the C9-Met-DNA is exerted, at least in part, by a CAAAG sequence that can sequester the endogenous inhibitory Tcf-4 and thereby promote transcription of osteopontin, the direct effector of metastasis in this system.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Molecular dynamics studies of trinucleotide repeat DNA involved in neurodegenerative disorders.

Expansion of trinucleotide repeat DNA of the classes CAG�·CTG, CGG�·CCG and GAA�·TTC are found to be associated with several neurodegenerative disorders. Different mechanisms have been attributed to the expansion of triplets, mainly involving the formation of alternate secondary structures by such repeats. This paper reports the molecular dynamics simulation of triplet repeat DNA sequences to study the basic structural features of DNA that are responsible for the formation of structures such as hairpins and slip-strand DNA leading to expansion. All the triplet repeat sequences studied were found to be more flexible compared to the control sequence unassociated with disease. Moreover, flexibility was found to be in the order CAG�·CTG > CGG�·CCG = GAA�·TTC, the highly flexible CAG�·CTG repeat being the most common cause of neurodegenerative disorders. In another simulation, a single G�·C to T�·A mutation at the 9th position of the CAG�·CTG repeat exhibited a reduction in bending compared to the pure 15-mer CAGâ�¢CTG repeat. EPM1 dodecamer repeat associated with the pathogenesis of progressive myoclonus epilepsy was also simulated and showed flexible nature suggesting a similar expansion mechanism.

Detection of a single DNA base-pair mismatch using an anthracene-tagged fluorescent probe

A novel anthracene-tagged oligonucleotide can discriminate between a fully-matched DNA target sequence and one with a single mismatching base-pair through a remarkable difference in fluorescence emission intensity upon duplex formation.

Structure of the adenylation domain of an NAD+-dependent DNA ligase

Background: DNA ligases catalyse phosphodiester bond formation between adjacent bases in nicked DNA, thereby sealing the nick. A key step in the catalytic mechanism is the formation of an adenylated DNA intermediate. The adenyl group is derived from either ATP (in eucaryotes and archaea) or NAD+4 (in bacteria). This difference in cofactor specificity suggests that DNA ligase may be a useful antibiotic target.

Results: The crystal structure of the adenylation domain of the NAD+-dependent DNA ligase from Bacillus stearothermophilus has been determined at 2.8 Å resolution. Despite a complete lack of detectable sequence similarity, the fold of the central core of this domain shares homology with the equivalent region of ATP-dependent DNA ligases, providing strong evidence for the location of the NAD+-binding site.

Conclusions: Comparison of the structure of the NAD+4-dependent DNA ligase with that of ATP-dependent ligases and mRNA-capping enzymes demonstrates the manifold utilisation of a conserved nucleotidyltransferase domain within this family of enzymes. Whilst this conserved core domain retains a common mode of nucleotide binding and activation, it is the additional domains at the N terminus and/or the C terminus that provide the alternative specificities and functionalities in the different members of this enzyme superfamily.

Tracking biological invasions in space and time: elucidating the invasive history of the green alga Codium fragile using old DNA

With the advent of 'ancient DNA' studies on preserved material of extant and extinct species, museums and herbaria now represent an important although still underutilized resource in molecular ecology. The ability to obtain sequence data from archived specimens can reveal the recent history of cryptic species and introductions. We have analysed extant and herbarium samples of the highly invasive green alga Codium fragile, many over 100 years old, to identify cryptic accessions of the invasive strain known as C. fragile ssp. tomentosoides, which can be identified by a unique haplotype. Molecular characterization of specimens previously identified as native in various regions shows that the invasive tomentosoides strain has been colonizing new habitats across the world for longer than records indicate, in some cases nearly 100 years before it was noticed. It can now be found in the ranges of all the other native haplotypes detected, several of which correspond to recognized subspecies. Within regions in the southern hemisphere there was a greater diversity of haplotypes than in the northern hemisphere, probably as a result of dispersal by the Antarctic Circumpolar Current. The findings of this study highlight the importance of herbaria in preserving contemporaneous records of invasions as they occur, especially when invasive taxa are cryptic.