997 resultados para BIOCHEMISTRY


Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fast synaptic neurotransmission is mediated by transmitter-activated conformational changes in ligand-gated ion channel receptors, culminating in opening of the integral ion channel pore. Human hereditary hyperekplexia, or startle disease, is caused by mutations in both the intracellular or extracellular loops flanking the pore-lining M2 domain of the glycine receptor alpha 1 subunit. These flanking domains are designated the M1-M2 loop and the M2-M3 loop respectively. We show that four startle disease mutations and six additional alanine substitution mutations distributed throughout both loops result in uncoupling of the ligand binding sites from the channel activation gate. We therefore conclude that the M1-M2 and M2-M3 loops act in parallel to activate the channel. Their locations strongly suggest that they act as hinges governing allosteric control of the M2 domain. As the members of the ligand-gated ion channel superfamily share a common structure, this signal transduction model may apply to all members of this superfamily.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

MHCPEP is a curated database comprising over 9000 peptide sequences known to bind MHC molecules. Entries are compiled from published reports as well as from direct submissions of experimental data. Each entry contains the peptide sequence, its MHC specificity and, when available, experimental method, observed activity, binding affinity, source protein, anchor positions and publication references. The present format of the database allows text string matching searches but can easily be converted for use in conjunction with sequence analysis packages. The database can be accessed via Internet using WWW, FTP or Gopher.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conantokin-G and conantokin-T are two paralytic polypeptide toxins originally isolated from the venom of the fish-hunting cone snails of the genus Conus. Conantokin-G and conantokin-T are the only naturally occurring peptidic compounds which possess N-methyl-D-aspartate receptor antagonist activity, produced by a selective non-competitive antagonism of polyamine responses, They are also structurally unusual in that they contain a disproportionately large number of acid labile post-translational gamma-carboxyglutamic acid (Gla) residues, Although no precise structural information has previously been published for these peptides, early spectroscopic measurements have indicated that both conantokin-G and conantokin-T form alpha-helical structures, although there is some debate whether the presence of calcium ions is required for these peptides to adopt this fold, We now report a detailed structural study of synthetic conantokin-G and conantokin-T in a range of solution conditions using CD and H-1 NMR spec troscopy. The three-dimensional structures of conantokin-T and conantokin-G were calculated from H-1 NMR-derived distance and dihedral restraints. Both conantokins were found to contain a mixture of alpha- and 3(10) helix, that give rise to curved and straight helical conformers. Conantokin-G requires the presence of divalent cations (Zn2+, Ca2+, Cu2+, Or Mg2+) to form a stable iv-helix, while conantokin-T adopts a stable alpha-helical structure in aqueous conditions, in the presence or absence of divalent cations (Zn2+, Ca2+, Cu2+, Or Mg2+).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The structure of the Tus-Ter DNA replication fork arrest complex of Escherichia coli reveals a novel architecture for the bound Tus protein and a new type of DNA-binding motif, The structure of the complex may explain how Tus can block movement of a replication fork approaching from one direction and not the other.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the replication terminator protein (RTP) and DNA terminator sites. While determination of the crystal structure of RTP has facilitated our understanding of how a single RTP dimer interacts with terminator DNA, additional information is required in order to understand the assembly of a functional fork arrest complex, which requires an interaction between two RTP dimers and the terminator site. In this study, we show that the conformation of the major B. subtilis DNA terminator, Terl, becomes considerably distorted upon binding RTP. Binding of the first dimer of RTP to the B site of Terl causes the DNA to become slightly unwound and bent by similar to 40 degrees. Binding of a second dimer of RTP to the A site causes the bend angle to increase to similar to 60 degrees. We have used this new data to construct two plausible models that might explain how the ternary terminator complex can block DNA replication in a polar manner, in the first model, polarity of action is a consequence of the two RTP-DNA half-sites having different conformations. These different conformations result from different RTP-DNA contacts at each half-site (due to the intrinsic asymmetry at the terminator DNA), as well as interactions (direct or indirect) between the RTP dimers on the DNA. In the second model, polar fork arrest activity is a consequence of the different affinities of RTP for the A and B sites of the terminator DNA, modulated significantly by direct or indirect interactions between the RTP dimers.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Although administration of 17 beta-estradiol (estrogen) following trauma-hemorrhage attenuates the elevation of cytokine production and mitogen-activated protein kinase (MAPK) activation in epidermal keratinocytes, whether the salutary effects of estrogen are mediated by estrogen receptor (ER)-alpha. or ER-beta is not known. To determine which estrogen receptor is the mediator, we subjected C3H/HeN male mice to trauma-hemorrhage (2-cm midline laparotomy and bleeding of the animals to a mean blood pressure of 35 mmHg and maintaining that pressure for 90 min) followed by resuscitation with Ringer`s lactate (four times the shed blood volume) At the middle of resuscitation we subcutaneously injected ER-alpha agonist propyl pyrazole trial (PPT; 5 mu g/kg), ER-beta agonist diarylpropionitrile (DPN; 5 mu g/kg), estrogen (50 mu g/kg), or ER antagonist ICI 182,780 (150 mu g/kg). Two hours after resuscitation, we isolated keratinocytes, stimulated them with lipopolysaccharide for 24 In (5 mu g/mL for maximum cytokine production), and measured the production of interleukin (IL)-6, IL-10, IL-12, and INF-alpha and the activation of MAPK. Keratinocyte cytokine production markedly increased and MAPK activation occurred following trauma-hemorrhage but were normalized by administration of estrogen, PPT and DPN. PPT and DPN administration were equally effective in normalizing the inflammatory response of keratinocytes, indicating that both ER-alpha. and ER-beta mediate the salutary effects of estrogen on kerotinocytes after trauma-hemorrhage.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The acute Porphyrias are examples of toxico-genetic diseases and diseases genetically acquired, which show an idiosyncratic reaction to certain chemicals and drugs. Porphyrics are at risk of developing an acute attack if exposed to various precipitating factors of which drugs are the most common factor. This paper presents lists of drugs complied into those hazardous for patients with acute porphyria and those thought to be safe.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Evidence that combined glucosamine sulfate and chondroitin sulfate (Gluchon) or isolated glucosamine (Glu) modifies joint damage in osteoarthritis (OA) is still lacking. We studied joint pain and cartilage damage using the anterior cruciate ligament transection (ACLT) model. Wistar rats were subjected to ACLT of the right knee ( OA) or sham operation. Groups received either Glu (500 mg/kg), Gluchon (500 mg/kg glucosamine +400 mg/kg chondroitin) or vehicle (non-treated-NT) per os starting 7 days prior to ACLT until sacrifice at 70 days. Joint pain was evaluated daily using the rat-knee joint articular incapacitation test. Structural joint damage was assessed using histology and biochemistry as the chondroitin sulfate ( CS) content of cartilage by densitometry (microgram per milligram dried cartilage), comparing to standard CS. The molar weight (Mw) of the CS samples, used as a qualitative biochemical parameter, was obtained by comparing their relative mobility on a polyacrylamide gel electrophoresis to standard CS. Gluchon, but not Glu, significantly reduced joint pain (P<0.05) compared to NT. There was an increase in CS content in the OA group (77.7 +/- 8.3 mu g/mg) compared to sham (53.5 +/- 11.2 mu g/mg) (P<0.05). The CS from OA samples had higher Mw (4:62 +/- 0:24 x 10(4) g/mol) compared to sham (4:18 +/- 0:19 x 10(4) g/mol) (P<0.05). Gluchon administration significantly reversed both the increases in CS content (54.4 +/- 12.1 mu g/mg) and Mw (4:18 +/- 0:2 x 104 g/mol) as compared to NT. Isolated Glu decreased CS content though not reaching statistical significance. Cartilage histology alterations were also significantly prevented by Gluchon administration. Gluchon provides clinical (analgesia) and structural benefits in the ACLT model. This is the first demonstration that biochemical alterations occurring in parallel to histological damage in OA are prevented by Gluchon administration.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The olfactory nervous system is responsible for the detection of odors. Primary sensory olfactory neurons are located in a neuroepithelial sheet lining the nasal cavity. The axons from these neurons converge on to discrete loci or glomeruli in the olfactory bulb. Each glomerulus consists of the termination of thousands of primary axons on the dendrites of second-order olfactory neurons. What are the molecular mechanisms which guide growing olfactory axons to select sites in the olfactory bulb? We have shown that subpopulations of these axons differentially express cell surface carbohydrates and that these different subpopulations target and terminate in particular regions of the olfactory bulb. Interestingly, the olfactory neurons and glial components in the olfactory pathway between the nose and brain express galectin-1. By using in vitro assays of neurite outgrowth we found that both galectin-1 and it's ligands were capable of specifically stimulating neurite elongation. Examination of the olfactory system in galectin-1 null mutants revealed that a subpopulation of axons failed to navigate to their target site in the olfactory bulb. This is the first phenotypic effect observed in galectin-1 null mutants and indicates that galectin-1 has a role in the growth and/or guidance of a subpopulation of axons in the olfactory system during development.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The mechanisms that initiate an inflammatory systemic response to a bacterial infection lead to a high mortality and constitute the first cause of death in Critical Care Units (ICU`s). Sepsis is a poorly understood disease and despite life support techniques and the administration of antibiotics, not much more can be done to improve its diagnosis and treatment. The present article has as main objective to discuss the role of neutrophils recruitment in sepsis, dissecting the molecular mechanisms implicated in this complex process and its importance to the pathogenesis of this outstanding cause of death.