Analysis Of The Ergosterol Biosynthesis Pathway Cloning, Molecular Characterization And Phylogeny Of Lanosterol 14 α-demethylase (erg11) Gene Of Moniliophthora Perniciosa.

The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

Apoplastic And Intracellular Plant Sugars Regulate Developmental Transitions In Witches' Broom Disease Of Cacao.

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.

Lymphocyte Activation In Silica-exposed Workers.

Exposure to silica dust has been examined as a possible risk factor for autoimmune diseases, including systemic sclerosis, rheumatoid arthritis, systemic lupus erythematosus and ANCA-associated vasculitis. However, the underlying cellular and molecular mechanisms resulting in the increased prevalence of autoimmunity remain elusive. To clarify these mechanisms, we studied various markers of immune activation in individuals occupationally exposed to silica dust, i.e., serum levels of soluble IL-2 receptor (sIL-2R), levels of IL-2, other pro- and anti-inflammatory cytokines and lymphoproliferation. Our results demonstrate that silica-exposed individuals present important alterations in their immune response when compared to controls, as shown by increased serum sIL-2R levels, decreased production of IL-2 and increased levels of the pro-inflammatory (IFN-γ, IL-1α, TNF-α, IL-6) as well as anti-inflammatory (IL-10 and TGF-β) cytokines. Furthermore, silica-exposed individuals presented enhanced lymphoproliferative responses. Our findings provide evidence that the maintenance of immune homeostasis may be disturbed in silica-exposed individuals, possibly resulting in autoimmune disorders.

Effect Of Atorvastatin On Wound Healing In Rats.

Skin-wound healing is a complex and dynamic biological process involving inflammation, proliferation, and remodeling. Recent studies have shown that statins are new therapeutical options because of their actions, such as anti-inflammatory and antioxidant activity, on vasodilation, endothelial dysfunction and neoangiogenesis, which are independent of their lipid-lowering action. Our aim was to investigate the effect of atorvastatin on tissue repair after acute injury in healthy animals. Rats were divided into four groups: placebo-treated (P), topical atorvastatin-treated (AT), oral atorvastatin-treated (AO), topical and oral atorvastatin-treated (ATO). Under anesthesia, rats were wounded with an 8-mm punch in the dorsal region. Lesions were photographed on Days 0, 1, 3, 7, 10, 12, and 14 post-injury and samples taken on Days 1, 3, 7, and 14 for protein-expression analysis of insulin receptor substrate (IRS)-1, phosphatidylinositol 3-kinase (PI3K), protein kinase B (Akt), glycogen synthase kinase (GSK)-3, endothelial nitric oxide synthase (eNOS), vascular endothelial growth factor (VEGF), extracellular signal-regulated kinase (ERK), interleukin (IL)-10, IL-1β, IL-6, and tumor necrosis factor (TNF)-α. Upon macroscopic examination, we observed significant reductions of lesion areas in groups AT, AO, and ATO compared to the P group. Additionally, AT and AO groups showed increased expression of IRS-1, PI3K, Akt, GSK-3, and IL-10 on Days 1 and 3 when compared with the P group. All atorvastatin-treated groups showed higher expression of IRS-1, PI3K, Akt, GSK-3, IL-10, eNOS, VEGF, and ERK on Day 7. On Days 1, 3, and 7, all atorvastatin-treated groups showed lower expression of IL-6 and TNF-α when compared with the P group. We conclude that atorvastatin accelerated tissue repair of acute lesions in rats and modulated expressions of proteins and cytokines associated with cell-growth pathways.

Increased Arterial Stiffness In Resistant Hypertension Is Associated With Inflammatory Biomarkers.

Increased levels of inflammatory biomarkers such as interleukin-6 (IL-6), 10 (IL-10), 1β (IL-1β), tumor necrosis factor-α (TNF-α) high-sensitivity C-reactive protein (hs-CRP) are associated with arterial stiffness in hypertension. Indeed, resistant hypertension (RHTN) leads to unfavorable prognosis attributed to poor blood pressure (BP) control and target organ damage. This study evaluated the potential impact of inflammatory biomarkers on arterial stiffness in RHTN. In this cross-sectional study, 32 RHTN, 20 mild hypertensive (HTN) and 20 normotensive (NT) patients were subjected to office BP and arterial stiffness measurements assessed by pulse wave velocity (PWV). Inflammatory biomarkers were measured in plasma samples. PWV was increased in RHTN compared with HTN and NT (p < 0.05). TNF-α levels were significantly higher in RHTN and HTN than NT patients. No differences in IL-6 levels were observed. RHTN patients had a higher frequency of subjects with increased levels of IL-10 and IL-1β compared with HTN and NT patients. Finally, IL-1β was independently associated with PWV (p < 0.001; R(2) = 0.5; β = 0.077). RHTN subjects have higher levels of inflammatory cytokines (TNF-α, IL-1β and IL-10) as well as increased arterial stiffness, and detectable IL-1β levels are associated arterial stiffness. These findings suggest that inflammation plays a possible role in the pathophysiology of RHTN.

Low-level Laser Therapy To The Mouse Femur Enhances The Fungicidal Response Of Neutrophils Against Paracoccidioides Brasiliensis.

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

Proinflammatory Activity Of Primarily Infected Endodontic Content Against Macrophages After Different Phases Of The Root Canal Therapy.

This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.

In Vivo Determination Of The Volatile Metabolites Of Saprotroph Fungi By Comprehensive Two-dimensional Gas Chromatography.

In this work, we discuss the use of multi-way principal component analysis combined with comprehensive two-dimensional gas chromatography to study the volatile metabolites of the saprophytic fungus Memnoniella sp. isolated in vivo by headspace solid-phase microextraction. This fungus has been identified as having the ability to induce plant resistance against pathogens, possibly through its volatile metabolites. Adequate culture media was inoculated, and its headspace was then sampled with a solid-phase microextraction fiber and chromatographed every 24 h over seven days. The raw chromatogram processing using multi-way principal component analysis allowed the determination of the inoculation period, during which the concentration of volatile metabolites was maximized, as well as the discrimination of the appropriate peaks from the complex culture media background. Several volatile metabolites not previously described in the literature on biocontrol fungi were observed, as well as sesquiterpenes and aliphatic alcohols. These results stress that, due to the complexity of multidimensional chromatographic data, multivariate tools might be mandatory even for apparently trivial tasks, such as the determination of the temporal profile of metabolite production and extinction. However, when compared with conventional gas chromatography, the complex data processing yields a considerable improvement in the information obtained from the samples. This article is protected by copyright. All rights reserved.

Muscle Hyperalgesia Induced By Peripheral P2x3 Receptors Is Modulated By Inflammatory Mediators.

ATP, via activation of P2X3 receptors, has been highlighted as a key target in inflammatory hyperalgesia. Therefore, the aim of this study was to confirm whether the activation of P2X3 receptors in the gastrocnemius muscle of rats induces mechanical muscle hyperalgesia and, if so, to analyze the involvement of the classical inflammatory mediators (bradykinin, prostaglandins, sympathetic amines, pro-inflammatory cytokines and neutrophil migration) in this response. Intramuscular administration of the non-selective P2X3 receptor agonist α,β-meATP in the gastrocnemius muscle of rats induced mechanical muscle hyperalgesia, which, in turn, was prevented by the selective P2X3 and P2X2/3 receptors antagonist A-317491, the selective bradykinin B1-receptor antagonist Des-Arg9-[Leu8]-BK (DALBK), the cyclooxygenase inhibitor indomethacin, the β1- or β2-adrenoceptor antagonist atenolol and ICI 118,551, respectively. Also, the nonspecific selectin inhibitor fucoidan. α,β-meATP induced increases in the local concentration of the pro-inflammatory cytokines tumor necrosis factor-α (TNF-α) and interleukin 1β (IL-1β), which were reduced by bradykinin antagonist. Finally, α,β-meATP also induced neutrophil migration. Together, these findings suggest that α,β-meATP induced mechanical hyperalgesia in the gastrocnemius muscle of rats via activation of peripheral P2X3 receptors, which involves bradykinin, prostaglandins, sympathetic amines, pro-inflammatory cytokines release and neutrophil migration. It is also indicated that bradykinin is the key modulator of the mechanical muscle hyperalgesia induced by P2X3 receptors. Therefore, we suggest that P2X3 receptors are important targets to control muscle inflammatory pain.

Clinical Influence Of Different Intracanal Medications On Th1-type And Th2-type Cytokine Responses In Apical Periodontitis.

This clinical study assessed the influence of different intracanal medications on Th1-type and Th2-type cytokine responses in apical periodontitis and monitored the levels of bacteria from primarily infection during endodontic procedures. Thirty primarily infected teeth were randomly divided into 3 groups according to the medication selected: chlorhexidine (CHX), 2% CHX gel; Ca(OH)2/SSL, Ca(OH)2 + SSL; and Ca(OH)2/CHX, Ca(OH)2 + 2% CHX gel (all, n = 10). Bacterial sample was collected from root canals, and the interstitial fluid was sampled from lesions. Culture techniques were used to determine bacterial counts (colony-forming units/mL). Th1 (tumor necrosis factor-α, interferon-γ, and interleukin [IL]-2) and Th2 cytokines (IL-4, IL-5, and IL-13) were measured by enzyme-linked immunosorbent assay. All intracanal medication protocols were effective in reducing the bacterial load from root canals (all P < .05) and lowering the levels of Th1-type cytokines in apical lesions (all P < .05), with no differences between them (P > .05). Both Ca(OH)2 treatment protocols significantly increased the levels of Th2-type cytokines (P < .05), with no differences between them (P > .05). Thus, chlorhexidine medication showed the lowest effectiveness in increasing the levels of Th2-type cytokine. After treatment, regardless of the type of medication, the linear regression analysis indicated the down-regulation of Th2-type cytokines by Th1-type cytokines. All intracanal medication protocols were effective in reducing bacterial load and lowering the levels of Th1-type cytokines. Thus, the use of Ca(OH)2 medications contributed to the increase in the Th2-type cytokine response in apical periodontitis.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Treinamento concorrente : efeito sobre marcadores inflamatórios sistêmicos e indicadores funcionais em homens de meia idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação da magnitude do dano muscular após ações excêntricas com diferentes velocidades em mulheres jovens e na pós-menopausa

Universidade Estadual de Campinas . Faculdade de Educação Física

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Pulp capping materials exert an effect on the secretion of IL-1β and IL-8 by migrating human neutrophils

Pulp repair is a complex process whose mechanisms are not yet fully understood. The first immune cells to reach the damaged pulp are neutrophils that play an important role in releasing cytokines and in phagocytosis. The objective of this study was to analyze the effect of different pulp-capping materials on the secretion of interleukin-1 beta (IL-1β) and interleukin-8 (IL-8) by migrating human neutrophils. Neutrophils were obtained from the blood of three healthy donors. The experimental groups were calcium hydroxide [Ca(OH)2], an adhesive system (Single Bond), and mineral trioxide aggregate (MTA). Untreated cells were used as control. Transwell chambers were used in performing the assays to mimic an in vivo situation of neutrophil chemotaxis. The pulp-capping materials were placed in the lower chamber and the human neutrophils, in the upper chamber. The cells were counted and the culture medium was assayed using ELISA kits for detecting and quantifying IL-1β and IL8. The data were compared by ANOVA followed by Tukey's test (p < 0.05). The secretion of IL-8 was significantly higher in all groups in comparison to the control group (p < 0.05). The adhesive system group showed higher IL-8 than the MTA group (p < 0.05). The secretion of IL-1β was significantly greater only in the MTA group (p < 0.001). It was concluded that only MTA is able to improve the secretion of IL-1β, and all materials tested increased IL-8 secretion. These results combined with all the other biological advantages of MTA indicate that it could be considered the material of choice for dental pulp capping.