Indução assimétrica 1,5-Anti na adição de enolatos de boro de metilcetonas beta-oxigenadas a aldeídos

High levels of substrate-based 1,5-stereoinduction are obtained in the boron-mediated aldol reactions of beta-oxygenated methyl ketones with achiral and chiral aldehydes. Remote induction from the boron enolates gives the 1,5-anti adducts, with the enolate pi-facial selectivity critically dependent upon the nature of the beta-alkoxy protecting group. This 1,5-anti aldol methodology has been strategically employed in the total synthesis of several natural products. At present, the origin of the high level of 1,5-anti induction obtained with the boron enolates is unclear, although a model based on a hydrogen bonding between the alkoxy oxygen and the formyl hydrogen has been recently proposed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Analysis of anti-Müllerian hormone (AMH) and its receptor (AMHR2) genes in patients with persistent Müllerian duct syndrome

OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8

Tua imensa torcida e bem feliz... da relação torcedor com o clube

Universidade Estadual de Campinas . Faculdade de Educação Física

Infectious endocarditis caused by Nocardia sp.: histological morphology as a guide for the specific diagnosis

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Anti-oxidative and anti-ulcerogenic activity of Ipomoea imperati

Ipomoea imperati (Vahl) Griseb., Convolvulaceae, is used in traditional medicine for the treatment of inflammation, swelling and wounds, as well as to treat pains and stomach problems. This work evaluates the anti-oxidative activity by ESR (Electron Spin Resonance spectroscopy) and the preventive and curative actions of I. imperati in gastric ulcer animal model. Ipomoea imperati (200 mg/kg, p.o.) prevented the formation of gastric lesions in 78% (p<0.05) when compared with the negative control tween 80. Lanzoprazole, prevented in 85% the gastric lesions formation induced by ethanol (p<0.05). Therefore, the oral administration of I. imperati one hour before the ulcerogenic agent prevented the ulcer formation, conserving the citoprotection characteristics of the gastric mucosa and assuring the integrity of gastric glands and gastric fossets. The healing activity of I. imperati (200 mg/kg, p.o.) evaluated in chronic ulcer experiments induced by the acetic acid, was 72% (p<0.05). The positive control, ranitidine, healed 78% of the gastric lesions (p<0.05). The histological analysis confirmed the recovery of the mucosal layer and the muscle mucosal layer harmed by the acetic acid. Experiments in vitro with DPPH (2.2-diphenyl-1-picrylhydrazyl) of anti-oxidative activity demonstrated that I. imperati presents an IC50 of 0.73±0.01 mg/mL.

Stress-induced neuroinflammation: mechanisms and new pharmacological targets

Stress is triggered by numerous unexpected environmental, social or pathological stimuli occurring during the life of animals, including humans, which determine changes in all of their systems. Although acute stress is essential for survival, chronic, long-lasting stress can be detrimental. In this review, we present data supporting the hypothesis that stress-related events are characterized by modifications of oxidative/nitrosative pathways in the brain in response to the activation of inflammatory mediators. Recent findings indicate a key role for nitric oxide (NO) and an excess of pro-oxidants in various brain areas as responsible for both neuronal functional impairment and structural damage. Similarly, cyclooxygenase-2 (COX-2), another known source of oxidants, may account for stress-induced brain damage. Interestingly, some of the COX-2-derived mediators, such as the prostaglandin 15d-PGJ2 and its peroxisome proliferator-activated nuclear receptor PPARγ, are activated in the brain in response to stress, constituting a possible endogenous anti-inflammatory mechanism of defense against excessive inflammation. The stress-induced activation of both biochemical pathways depends on the activation of the N-methyl-D-aspartate (NMDA) glutamate receptor and on the activation of the transcription factor nuclear factor kappa B (NFκB). In the case of inducible NO synthase (iNOS), release of the cytokine TNF-α also accounts for its expression. Different pharmacological strategies directed towards different sites in iNOS or COX-2 pathways have been shown to be neuroprotective in stress-induced brain damage: NMDA receptor blockers, inhibitors of TNF-α activation and release, inhibitors of NFκB, specific inhibitors of iNOS and COX-2 activities and PPARγ agonists. This article reviews recent contributions to this area addressing possible new pharmacological targets for the treatment of stress-induced neuropsychiatric disorders.

Anticorpos contra LDL-ox e síndrome coronariana aguda

FUNDAMENTO: A oxidação da lipoproteína de baixa densidade (LDL-ox) induz à formação de epítopos imunogênicos na molécula. A presença de autoanticorpos contra a LDL-ox tem sido demonstrada no soro de pacientes com doença arterial coronariana (DAC). Contudo, o papel desses autoanticorpos na fisiopatologia das síndromes coronarianas agudas (SCA) e o seu significado clínico permanecem indefinidos. OBJETIVO: Avaliar a associação entre autoanticorpos contra a LDL-ox e SCA. MÉTODOS: Os títulos de imunoglobulina G autoanticorpos contra a LDL-ox por cobre (antiLDL-ox) e contra o peptídeo sintético D derivado da apolipoproteína B (antipeptD) foram determinados por ensaio imunoenzimático (ELISA) em 90 pacientes, nas primeiras 12h de SCA (casos) e em 90 pacientes com DAC crônica (controles). RESULTADOS: Os resultados mostraram que os títulos de antiLDL-ox foram significativamente mais elevados (p = 0,017) nos casos (0,40 ± 0,22), do que nos controles (0,33 ± 0,23). Por outro lado, os títulos de antipeptD foram significativamente menores (p < 0,01) nos casos (0,28 ± 0,23) do que nos controles (0,45 ± 0,30). A diferença dos títulos de ambos anticorpos entre os dois grupos estudados foi independente de idade, sexo, hipertensão arterial, diabete melito, dislipidemia, índice de massa corporal, tabagismo, perfil lipídico, uso de estatinas e história familiar de DAC. CONCLUSÃO: Os resultados mostraram que os títulos de antiLDL-ox foram significativamente mais elevados nos pacientes com síndrome coronariana aguda quando comparados aos pacientes com doença arterial coronariana e podem estar associados à instabilidade da placa aterosclerótica.

Caracterização físico-química de polpas de frutos da Amazônia e sua correlação com a atividade anti-radical livre

Características físico-químicas (cor, pH, acidez total titulável, sólidos solúveis totais, conteúdo de lipídios e umidade) e níveis de compostos bioativos (ácido ascórbico, fenólicos totais) foram determinados em quinze amostras de polpas de frutos procedentes da região Amazônica (abiu, acerola, açaí, araçá-boi, bacaba, bacuri, buriti, cajá, cajarana, caju, cupuaçu, graviola, murici, noni e tamarindo). A atividade de radicais livres foi avaliada pelo método de ABTS. Algumas polpas apresentaram alta potencialidade antioxidante, associada com a atividade antirradicais livres obtida e os conteúdos dos componentes bioativos como compostos fenólicos e ácido ascórbico, destacando-se acerola e acaí. O conteúdo total de compostos fenólicos foi correlacionado à capacidade antioxidante das polpas.

Validação e reprodutibilidade de uma escala de auto-eficácia para adesão ao tratamento anti-retroviral em pais ou cuidadores de crianças e adolescentes vivendo com HIV/AIDS

OBJETIVO: Validar uma escala de auto-eficácia para adesão ao tratamento anti-retroviral em crianças e adolescentes com HIV/AIDS, levando em consideração a perspectiva dos pais/responsáveis, e avaliar a sua reprodutibilidade. MÉTODOS: O estudo foi realizado no Hospital-Dia do Centro de Referência e Treinamento em DST/AIDS de São Paulo. Foram entrevistados os pais/responsáveis de 54 crianças e adolescentes de 6 meses a 20 anos que passaram em consulta de rotina pelo serviço. Os dados de auto-eficácia foram levantados pela escala de auto-eficácia para seguir prescrição anti-retroviral (AE), que foi calculada de duas maneiras: análise fatorial e fórmula já definida. A consistência interna da escala foi verificada pelo coeficiente ade Cronbach. A validade foi avaliada pela comparação das médias dos escores entre grupos de pacientes aderentes e não aderentes ao tratamento anti-retroviral (teste de Mann-Whitney) e cálculo do coeficiente de correlação de Spearman entre os escores e parâmetros clínicos. A reprodutibilidade foi verificada por meio do teste de Wilcoxon, pelo coeficiente de correlação intraclasse (CCI) e pelo gráfico de Bland-Altman. RESULTADOS: A escala de AE apresentou boa consistência interna (a= 0,87) e boa reprodutibilidade (CCI = 0,69 e CCI = 0,75). Quanto à validade, a escala de AE conseguiu discriminar pacientes aderentes e não aderentes ao tratamento anti-retroviral (p = 0,002) e apresentou correlação significativa com a contagem de CD4 (r = 0,28; p = 0,04). CONCLUSÕES: A escala de AE pode ser utilizada para avaliar a adesão à terapia anti-retroviral em crianças e adolescentes com HIV/AIDS, levando em consideração a perspectiva dos pais/cuidadores.

Auto-anticorpos anti-LDLox e sua correlação com o perfil lipídico e o estado nutricional de adolescentes

OBJETIVO: Avaliar se o conteúdo de auto-anticorpos anti-LDL oxidada (anti-LDLox) no plasma de adolescentes correlaciona-se com suas medidas antropométricas e com o perfil lipídico. MÉTODOS: O estudo incluiu 150 adolescentes com idade entre 10 e 15 anos, recrutados do ambulatório de obesidade da Universidade Federal de São Paulo (SP) e de escolas públicas de Piracicaba (SP). Foram avaliadas medidas antropométricas, como índice de massa corporal, circunferência de cintura e do braço, classificando os adolescentes em eutrófico, sobrepeso e obeso. Para as análises bioquímicas, foi realizado o perfil lipídico através de métodos enzimáticos colorimétricos, e para detecção do conteúdo de auto-anticorpos anti-LDLox, utilizou-se o método de ELISA. RESULTADOS: Segundo análises das variáveis antropométricas, o grupo obeso apresentou perfil alterado em relação aos grupos eutrófico e sobrepeso (p < 0,01), indicando risco cardiovascular. Quando o perfil lipídico foi avaliado, observaram-se diferenças estatisticamente significativas para as concentrações de colesterol total (p = 0,011), HDL-colesterol (p = 0,001) e LDL-colesterol (p < 0,042) nos grupos eutrófico e obeso. Para as análises de auto-anticorpos anti-LDLox plasmática, os grupos sobrepeso (p = 0,012) e obeso (p < 0,001) apresentaram valores superiores ao grupo eutrófico. Também houve correlações entre os auto-anticorpos anti-LDLox e variáveis antropométricas. CONCLUSÃO: A presença de auto-anticorpos anti-LDLox em adolescentes e as alterações metabólicas no perfil lipídico variaram de modo proporcional com parâmetros antropométricos, o que torna o conteúdo de anti-LDLox um potencial indicador bioquímico de risco para síndrome metabólica.

Efeito de medicamentos indicados para a prevenção da mastite bovina no período seco sobre a função fagocítica in vitro de leucócitos do leite de caprinos

O uso de medicamentos antimamíticos específicos para vacas no período seco é indicado para prevenção de infecções na lactação seguinte. Não obstante, a ação das células envolvidas no período de secagem tem fundamental importância para a involução da glândula mamária e seu restabelecimento para a lactação subseqüente. A indisponibilidade de tais medicamentos para uso em cabras tem resultado na extrapolação do uso de produtos recomendados para vacas sem que se considerem as particularidades e diferenças anátomo-fisiológicas entre as espécies bovina e caprina. O presente estudo teve por objetivo avaliar a influência de cinco antimamíticos específicos para vacas secas sobre a função dos fagócitos provenientes de leite caprino. Para tal, fez-se o isolamento de células somáticas de 20 amostras de leite provenientes de 10 cabras lactantes, sem antecedentes de tratamento de mamite nos últimos 30 dias, sob condições higiênico-sanitárias de colheita e com resultados negativos ao cultivo microbiológico do leite. As células aderidas a lamínulas de vidro foram confrontadas com formulações contendo princípios ativos disponíveis no mercado como Gentamicina (M1), Cefalônio Anidro (M2), Ampicilina (M3), Cloxacilina Benzatínica (M4) e Cefapirina Benzatínica (M5). Avaliou-se, por microscopia, a fagocitose de partículas de Zymosan. As médias dos índices de fagocitose das células submetidas ao tratamento com M2 (15,12% ± 16,22), M3 (6,02% ± 7,96), M4 (4,54% ± 5,45) e M5 (2,47% ± 4,64) foram menores (p<0,001) que a média dos índices de fagocitose do grupo controle (40,67% ± 19,68). A média dos índices de fagocitose das células submetidas ao tratamento com M2 foi maior (p<0,05) que as médias dos tratamentos com M3, M4 e M5 enquanto estas foram estatisticamente iguais entre si. As amostras celulares submetidas ao medicamento M1 exibiram adesão insuficiente ou ausente às lamínulas, inviabilizando a avaliação da fagocitose por meio da técnica utilizada. Os resultados obtidos permitem concluir que os medicamentos estudados exerceram influência negativa sobre os fagócitos do leite, porém, esta interferência sobre as funções das células somáticas não pode por si só determinar o insucesso da terapia proposta para o período seco, pois deve ser considerada, outrossim, a eficácia do princípio ativo sobre o patógeno causador do processo infeccioso.

Evaluation of a recombinant p24 antigen for the detection of Feline Immunodeficiency Virus-specific antibodies

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

AT1-receptor mediated vascular damage in myocardium, kidneys and liver in rats

The systemic aspect of vascular damage induced by angiotensin II (ANG II) has been poorly explored in the literature. Considering the presence of ANG II and its specific receptor AT1, in several organs, all tissues might be potentially affected by its effects. The aims of this study were: To evaluate the early histological changes in the heart, liver and kidneys, produced by ANG II infusion, to evaluate the protective effect of losartan. Wistar rats were distributed into three groups: control (no treatment), treated with ANG II, and treated with ANG II + losartan. ANG II was continuously infused over 72 hours by subcutaneous osmotic pumps. Histological sections of the myocardium, kidneys and liver were stained and observed for the presence of necrosis. There were ANG II-induced perivascular inflammation and necrosis of the arteriolar wall in the myocardium, kidney, and liver by, which were partially prevented by losartan. There was no significant correlation between heart and kidney damage. Tissue lesion severity was lower than that of vascular lesions, without statistical difference between groups. ANG II causes vascular injury in the heart, kidneys and liver, indicating a systemic vasculotoxic effect; the mechanisms of damage/protection vary depending on the target organ; perivascular lesions may occur even when anti-hypertensive doses of losartan are used.