Spectrophotometric Evaluation Of Dental Bleaching Under Orthodontic Bracket In Enamel And Dentin.

Aware of the diffusion capacity of bleaching in the dental tissues, many orthodontists are subjecting their patients to dental bleaching during orthodontic treatment for esthetic purposes or to anticipate the exchange of esthetic restorations after the orthodontic treatment. For this purpose specific products have been developed in pre-loaded whitening trays designed to fit over and around brackets and wires, with clinical efficacy proven. The objective of this study was to evaluate, through spectrophotometric reflectance, the effectiveness of dental bleaching under orthodontic bracket. Thirty-two bovine incisors crown blocks of 8 mm x 8 mm height lengths were used. Staining of tooth blocks with black tea was performed for six days. They were distributed randomly into 4 groups (1-home bleaching with bracket, 2- home bleaching without bracket, 3- office bleaching with bracket, 4 office bleaching without bracket). The color evaluation was performed (CIE L * a * b *) using color reflectance spectrophotometer. Metal brackets were bonded in groups 1 and 3. The groups 1 and 2 samples were subjected to the carbamide peroxide at 15%, 4 hours daily for 21 days. Groups 3 and 4 were subjected to 3 in-office bleaching treatment sessions, hydrogen peroxide 38%. After removal of the brackets, the second color evaluation was performed in tooth block, difference between the area under the bracket and around it, and after 7 days to verified color stability. Data analysis was performed using the paired t-test and two-way variance analysis and Tukey's. The home bleaching technique proved to be more effective compared to the office bleaching. There was a significant difference between the margin and center color values of the specimens that were subjected to bracket bonding. The bracket bond presence affected the effectiveness of both the home and office bleaching treatments. Key words:Tooth bleaching, spectrophotometry, orthodontics.

In Vitro Effects Of Hydrogen Peroxide Combined With Different Activators For The In-office Bleaching Technique On Enamel.

Abstract Objective. The aim of this study was to evaluate the alteration of human enamel bleached with high concentrations of hydrogen peroxide associated with different activators. Materials and methods. Fifty enamel/dentin blocks (4 × 4 mm) were obtained from human third molars and randomized divided according to the bleaching procedure (n = 10): G1 = 35% hydrogen peroxide (HP - Whiteness HP Maxx); G2 = HP + Halogen lamp (HL); G3 = HP + 7% sodium bicarbonate (SB); G4 = HP + 20% sodium hydroxide (SH); and G5 = 38% hydrogen peroxide (OXB - Opalescence Xtra Boost). The bleaching treatments were performed in three sessions with a 7-day interval between them. The enamel content, before (baseline) and after bleaching, was determined using an FT-Raman spectrometer and was based on the concentration of phosphate, carbonate, and organic matrix. Statistical analysis was performed using two-way ANOVA for repeated measures and Tukey's test. Results. The results showed no significant differences between time of analysis (p = 0.5175) for most treatments and peak areas analyzed; and among bleaching treatments (p = 0.4184). The comparisons during and after bleaching revealed a significant difference in the HP group for the peak areas of carbonate and organic matrix, and for the organic matrix in OXB and HP+SH groups. Tukey's analysis determined that the difference, peak areas, and the interaction among treatment, time and peak was statistically significant (p < 0.05). Conclusion. The association of activators with hydrogen peroxide was effective in the alteration of enamel, mainly with regards to the organic matrix.

Preservation Of The External Jugular Vein In Bilateral Radical Neck Dissections: Technique In Two Cases And Review Of The Literature.

Context. The possibility of cephalic venous hypertension with the resultant facial edema and elevated cerebrospinal fluid pressure continues to challenge head and neck surgeons who perform bilateral radical neck dissections during simultaneous or staged procedures. Case Report. The staged procedure in patients who require bilateral neck dissections allows collateral venous drainage to develop, mainly through the internal and external vertebral plexuses, thereby minimizing the risks of deleterious consequences. Nevertheless, this procedure has disadvantages, such as a delay in definitive therapy, the need for a second hospitalization and anesthesia, and the risk of cutting lymphatic vessels and spreading viable cancer cells. In this paper, we discuss the rationale and feasibility of preserving the external jugular vein. Considering the limited number of similar reports in the literature, two cases in which this procedure was accomplished are described. The relevant anatomy and technique are reviewed and the patients' outcomes are discussed. Conclusion. Preservation of the EJV during bilateral neck dissections is technically feasible, fast, and safe, with clinically and radiologically demonstrated patency.

Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Rehabilitation of severely resorbed edentulous mandible using the modified visor osteotomy technique

The prosthetic rehabilitation of an atrophic mandible is usually unsatisfactory due to the lack of support tissues, mainly bone and keratinized mucosa for treatment with osseointegrated implants or even conventional prosthesis. The prosthetic instability leads to social and functional limitations and chronic physical trauma decreasing the patient's quality of life. A 53-year-old female patient sought care at our surgical service complaining of impairment of her masticatory function associated with the instability of the lower total prosthetic denture. The clinical and complementary exams revealed edentulism in both arches, while the mandibular arch presented severe reabsorption resulting in denture instability and chronic trauma to the oral mucosa. The proposed treatment plan consisted in the mandibular rehabilitation with osseointegrated implants and fixed Brånemark's protocol prosthesis after mandibular reconstruction applying the modified visor osteotomy technique. The proposed technique offered predictable results for reconstruction of the severely resorbed edentulous mandible and posterior rehabilitation with osseointegrated implants.

Effect of staining solutions and repolishing on color stability of direct composites

OBJECTIVES: The purpose of this study was to assess the color change of three types of composite resins exposed to coffee and cola drink, and the effect of repolishing on the color stability of these composites after staining. MATERIALS AND METHODS: Fifteen specimens (15 mm diameter and 2 mm thick) were fabricated from microhybrid (Esthet-X; Dentsply and Filtek Z-250; 3M ESPE) and high-density hybrid (Surefil; Dentsply) composites, and were finished and polished with aluminum oxide discs (Sof-Lex; 3M ESPE). Color of the specimens was measured according to the CIE L*a*b* system in a refection spectrophotometer (PCB 6807; BYK Gardner). After baseline color measurements, 5 specimens of each resin were immersed in different staining solutions for 15 days: G1 - distilled water (control), G2 - coffee, G3 - cola soft drink. Afterwards, new color measurement was performed and the specimens were repolished and submitted to new color reading. Color stability was determined by the difference (ΔE) between the coordinates L*, a*, and b* obtained from the specimens before and after immersion into the solutions and after repolishing. RESULTS: There was no statistically signifcant difference (ANOVA, Tukey's test; p>0.05) among the ΔE values for the different types of composites after staining or repolishing. For all composite resins, coffee promoted more color change (ΔE>3.3) than distilled water and the cola soft drink. After repolishing, the ΔE values of the specimens immersed in coffee decreased to clinically acceptable values (ΔE<3.3), but remained signifcantly higher than those of the other groups. CONCLUSIONS: No signifcant difference was found among composite resins or between color values before and after repolishing of specimens immersed in distilled water and cola. Immersing specimens in coffee caused greater color change in all types of composite resins tested in this study and repolishing contributed to decrease staining to clinically acceptable ΔE values.

Effect of ageing and immersion in different beverages on properties of denture lining materials

OBJECTIVES: To evaluate the color stability and hardness of two denture liners obtained by direct and indirect techniques, after thermal cycling and immersion in beverages that can cause staining of teeth. MATERIAL AND METHODS: Seventy disc-shaped specimens (18 x 3 mm) processed by direct (DT) and indirect techniques (IT) were made from Elite soft (n=35) and Kooliner (n=35) denture liners. For each material and technique, 10 specimens were subjected to thermal cycling (3,000 cycles) and 25 specimens were stored in water, coffee, tea, soda and red wine for 36 days. The values of color change, Shore A hardness (Elite soft) and Knoop hardness (Kooliner) were obtained. The data were subjected to ANOVA, Tukey's multiple-comparison test, and Kruskal-Wallis test (P<0.05). RESULTS: The thermal cycling promoted a decrease on hardness of Kooliner regardless of the technique used (Initial: 9.09± 1.61; Thermal cycling: 7.77± 1.47) and promoted an increase in the hardness in the DT for Elite Soft (Initial: 40.63± 1.07; Thermal cycling: 43.53± 1.03); hardness of Kooliner (DT: 8.76± 0.95; IT: 7.70± 1.62) and Elite Soft (DT: 42.75± 1.54; IT=39.30± 2.31) from the DT suffered an increase after the immersion in the beverages. The thermal cycling promoted color change only for Kooliner in the IT. Immersion in the beverages did not promote color change for Elite in both techniques. The control group of the DT of Kooliner showed a significant color change. Wine and coffee produced the greatest color change in the DT only for Elite Soft when compared to the other beverages. CONCLUSION: The three variation factors promoted alteration on hardness and color of the tested denture lining materials.

Interaction between staining and degradation of a composite resin in contact with colored foods

Composite resins might be susceptible to degradation and staining when in contact with some foods and drinks. This study evaluated color alteration and changes in microhardness of a microhybrid composite after immersion in different colored foods and determined whether there was a correlation between these two variables. Eighty composite disks were randomly divided into 8 experimental groups (n = 10): kept dry; deionized water; orange juice; passion fruit juice; grape juice; ketchup; mustard and soy sauce. The disks were individually immersed in their respective test substance at 37 ºC, for a period of 28 days. Superficial analysis of the disk specimens was performed by taking microhardness measurements (Vickers, 50 g load for 45 seconds) and color alterations were determined with a spectrophotometer (CINTRA 10- using a CIEL*a*b* system, 400-700 nm wavelength, illuminant d65 and standard observer of 2º) at the following times: baseline (before immersion), 1, 7, 14, 21 and 28 days. Results were analyzed by ANOVA and Tukey's test (p < 0.05). Both variables were also submitted to Pearson's correlation test (p < 0.05). The passion fruit group underwent the greatest microhardness change, while the mustard group suffered the greatest color alteration. Significant positive correlation was found between the two variables for the groups deionized water, grape juice, soy sauce and ketchup. Not all color alteration could be associated with surface degradation.

Medida da visão em candelas: description of a psychophysical technique to quantify luminous intensity

OBJETIVO: Desenvolver um método e um dispositivo para quantificar a visão em candela (cd). Os estudos de medida da visão são importantes para todas as ciências visuais. MÉTODOS: É um estudo teórico e experimental. Foram descritos os detalhes do método psicofísico e da calibração do dispositivo. Foram realizados testes preliminares em voluntários. RESULTADOS: É um teste psicofísico simples e com resultado expresso em unidades do sistema internacional de medidas. Com a descrição técnica será possível reproduzir o experimento em outros centros de pesquisa. CONCLUSÃO: Os resultados aferidos em intensidade luminosa (cd) são uma opção para estudo visual. Esses resultados possibilitarão extrapolar medidas para modelos matemáticos e para simular efeitos individuais com dados aberrométricos.

Ocorrência de Giardia, Cryptosporidium e microsporídios em animais silvestres em área de desmatamento no Estado de São Paulo, Brasil

A ocorrência de Giardia, Cryptosporidium e microsporídios foi investigada por meio da análise de 98 amostras fecais de animais silvestres capturados em uma área de desmatamento para a construção das barragens de Paraitinga e Biritiba, localizadas nos Municípios de Mogi das Cruzes, Salesópolis e Biritiba-Mirim, no Estado de São Paulo. As amostras foram obtidas de 46 roedores, 21 marsupiais, 16 sapos, nove morcegos, três primatas e três lagartos. As técnicas de centrífugo-flutuação com sulfato de zinco, de Kinyoun e a coloração de Gram-Chromotrope foram utilizadas, respectivamente, para a pesquisa de Giardia, de Cryptosporidium e de microsporídios. O total de animais parasitados por um dos protozoários investigados foi de 17,35% (17/98). Cistos de Giardia foram encontrados em amostras fecais de dois pequenos roedores da espécie Coendou villosus (ouriço-cacheiro). Os três animais positivos para Cryptosporidium foram roedores das espécies Akodon montensis, Thaptomys nigrita (ambos conhecidos como ratos do mato) e Sciurus aestuans (serelepe ou caxinguelê). Esporos de microsporídios foram encontrados nas fezes de 12 animais, sendo seis roedores das espécies Oligoryzomys sp.(um), Akodon montensis (três) e Coendou villosus (dois), três marsupiais pertencentes às espécies Didelphis aurita (dois) e Marmosops incanus (um) e três morcegos da espécie Diphylla ecaudata. Este é o primeiro relato de microsporidiose em animais silvestres no Brasil. A presente investigação enfatiza a importância de animais silvestres, particularmente pequenos mamíferos, como potenciais fontes de infecção desses protozoários para outras populações animais, incluindo o homem, em áreas de desmatamento.

EMJH medium with 5-fluorouracil and nalidixic acid associated with serial dilution technique used to recover Leptospira spp from experimentally contaminated bovine semen

Bovine semen experimentally contaminated with Leptospira santarosai serovar Guaricura was submitted to the modified EMJH medium with 5-fluorouracil (300mg/L) and nalidixic acid (20mg/L), named as "selective medium" and using the serial dilution technique, in order to evaluate the percentage of recovery of the added microorganism. The selective EMJH medium was found with higher percentage of recovery of leptospiras and minor losses of samples due to contamination with opportunistic microorganisms than the non-selective EMJH medium: 151/376 (40.0%) of positive growth; and 38/376 (10.0%) contamination and 58/376 (15%) and 129/376 (34.0%), respectively. These results were statistically significant (p<0. 0001; Fisher). Differences were found when the frequencies of positive leptospires recovery have been compared in the serial dilution technique (10-1 to 10-4) between the selective and non-selective media at different dilution factors. At 1/10th dilution the percentages found were (0%, 0/80) and (38%, 30/80), at 1/100th dilution, (3%, 2/80) and (49%, 39/80) and at 1/1,000th dilution, (25%, 20/80) and (50%, 40/80), respectively. The percentage of recovery of leptospires was found to be directly proportional to the dilution used. The methodology of the serial dilution technique (setting at least three dilutions) and the use of selective EMJH medium have been found to be efficient for the isolation of leptospires from the bovine semen samples.

Damage assessment of the equine sperm membranes by fluorimetric technique

To validate a practical technique of simultaneous evaluation of the plasma, acrosomal and mitochondrial membranes in equine spermatozoa three fluorescent probes (PI, FITC-PSA and MITO) were associated. Four ejaculates from three stallions (n=12) were diluted in TALP medium and split into 2 aliquots, 1 aliquot was flash frozen in liquid nitrogen to induce damage in cellular membranes. Three treatments were prepared with the following fixed ratios of fresh semen: flash frozen semen: 100:0 (T100), 50:50 (T50), and 0:100 (T0). A 150-µL aliquot of diluted semen of each treatment was added of 2 µL of PI, 2 µL of MITO and 80 µL of FITC-PSA; incubated at 38.5ºC/8 min, and sperm cells were evaluated by epifluorescent microscopy. Based in regression analysis, this could be an efficient and practical technique to assess damage in equine spermatozoa, as it was able to determine the sperm percentage more representative of the potential to fertilize the oocyte.

Evaluation technique for determining wheel performance in the grinding of aerospace materials

Nickel-based super alloys are used in a variety of applications in which high-temperature strength and resistance to creep, corrosion, and oxidation are required, such as in aircraft gas turbines, combustion chambers, and automotive engine valves. The properties that make these materials suitable for these applications also make them difficult to grind. Grinding systems for such materials are often built around vitrified cBN (cubic boron nitride) wheels to realize maximum productivity and minimum cost per part. Conditions that yield the most economical combination of stock removal rate and wheel wear are key to the successful implementation of the grinding system. Identifying the transition point for excessive wheel wear is important. The aim of this study is to compare the performance of different cBN wheels when grinding difficult-to-grind (DTG) materials by determining the 'wheel wear characteristic curve', which correlates the G-ratio to the calculated tangential force per abrasive grain. With the proposed methodology, a threshold force per grit above which the wheel wear rate increases rapidly can be quickly identified. A comparison of performance for two abrasive product formulations in the grinding of three materials is presented. The obtained results can be applied for the development of grinding applications for DTG materials.