944 resultados para maturity stages
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
This paper characterizes the developmental stages of the testes and vasa deferentia of the Panulirus echinatus Smith, 1869 through comparisons between microscopic findings, macroscopic aspects, and gonadosomatic index (GSR). The lobsters were sampled monthly (November 1999 to October 2000) using seine nets and a total of 1716 males were obtained at Tamandare Bay. Each carapace was cut to allow evaluation of the reproductive organs; the testes and vasa deferentia were dissected, weighed, fixed in Bouin`s solution up to 12 hours and submitted for histological analysis to determine the presence and/or absence of spermatozoa. These measures, along with change in color, size, diameter, development of the spermatophores and the GSR allowed the caracterization of three development stages: immature, intermediate and ripe. In conclusion, the maturity of the testes precedes the maturity of the vasa deferentia. To evaluate if gonadosomatic relation was a good quantitative indicator of the maturity stage, t tests (alpha = 0,05) were used and verified significant difference in the averages of GSR. The statistics corroborated that GSR can be used as indicative of the developmental stages for P. echinatus.
Resumo:
Life cycle models have become important in explaining the changing size structure of firms based on the carrying capacity of regions or industries. In particular, the population ecology model predicts stages of growth, maturity and eventually decline in the number of firms in an industry. There has been criticism of such models because of their focus on external variables as pre-determinants of the potential for enterprise development. This paper attempts to reconcile the external focus of the population ecology model with relevant internal management factors in enterprise development. A survey was conducted of Australian services exporters, and the results not only confirm the existence of four separate life cycle stages in the population ecology model, but also identify the external and internal variables that are strategically relevant at each of the stages. The findings provide potentially useful information in a range of contexts including the design of small business assistance as well a providing “guide posts” to entrepreneurs engaged in enterprise development.
Resumo:
Guayule (Parthenium argentatum Gray) is a rubber-producing shrub native to the semi-arid region of north central Mexico and southwestern Texas. Timely harvest is critical to achieve maximum seed viability, vigour, and yield. The objective of this study was to investigate possible indicators of optimum seed maturity in guayule. The optimum harvest maturity time for guayule was studied by comparing quality parameters at different times after flowering. Heat units expressed as growing degree-days after flowering were calculated and related to seed development stages and quality. Seed quality at different stages of development was assessed by germination, capitulum dry mass, 1000 seed mass, and percentage of filled seeds. The maximum seed quality was recorded at 329 growing degree-days (GDD). This was 28 days from time of flowering. At this date, the moisture content of the capitulum was 48% on a wet basis and the colour was comparable to cinnamon (Code 165C) on the Royal Horticultural Society (R.H.S.) standard colour chart. Of all the parameters GDD, 1000 seed mass, and percentage of filled seeds provided a more rapid and reliable measure of optimum seed maturity. Colour identification can be used as an additional indicator. (C) 2005 Elsevier B.V. All rights reserved.
Resumo:
Dose response curves to various supplements were established in two pen-feeding experiments (Exp1 and Exp2) with Bos indicus crossbred steers of two age groups (Young, 10–12 months; Old, 33–36 months) fed low-quality tropical grass hays ad libitum. Diets included supplements based on (Exp1) cottonseed meal (CSM; intake (as fed) 0–10 g/kg liveweight (W).day) and a barley mix (Bar; 0–20 g/kg W.day) and (Exp2) a molasses mix (MUP) and a Bar mix, both fed at 0–20 g/kg W.day. Urea was provided with the Bar mixes and urea/copra meal with the MUP mix. Growth rates of Young steers increased linearly with Bar and MUP supplements but asymptotically with CSM whereas those of Old steers increased asymptotically with all supplement types. With supplement intake expressed on a liveweight basis (g/kg W.day), responses were greater for both steer age groups with CSM compared with Bar (Young, P < 0.001; Old, P < 0.01) and Bar compared with MUP treatments (Young, P < 0.01; Old, P < 0.05). Furthermore, Old steers outperformed their Young counterparts with both CSM (P < 0.05) and Bar (P < 0.001) supplements fed in Exp1 and with Bar and MUP supplements (P < 0.01) fed in Exp2. When supplement intake was expressed in absolute terms (kg/day), growth responses were not different between age groups for different supplements except that Old steers had a higher daily W gain on Bar than their Young counterparts (P < 0.05). Intake of hay (W-corrected) was higher for Young compared with Old steers without supplement but was variably reduced for both steer groups with increasing supplement intake. The results of these experiments have implications for supplement formulation for steers at different stages of maturity grazing low-quality forages.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
A new species of the relatively poorly known Neotropical freshwater stingray genus Plesiotrygon Rosa, Castello & Thorson, 1987 is described from the main channel and smaller tributaries (Ríos Itaya and Pachitea) of the upper Amazon basin in Peru. The first specimen to be collected, however, was from much farther east in Rio Solimões in 1996, just down-river from Rio Purus (specimen unavailable for this study). Plesiotrygon nana sp. nov., is a very distinctive and unusually small species of freshwater stingray (Potamotrygonidae), described here mostly from three specimens representing different size classes and stages of sexual maturity. Plesiotrygon nana sp. nov., is distinguished from its only congener, P. iwamae Rosa, Castello & Thorson, 1987, by numerous unique features, including: dorsal coloration composed of very fine rosettes or a combination of spots and irregular ocelli; very circular disc and snout; very small and less rhomboidal spiracles; short snout and anterior disc region; narrow mouth and nostrils; denticles on dorsal tail small, scattered, not forming row of enlarged spines; adult and preadult specimens with significantly fewer tooth rows; fewer caudal vertebrae; higher total pectoral radials; very small size, probably not surpassing 250 mm disc length or width, males maturing sexually at around 180 mm disc length and 175 mm disc width; distal coloration of tail posterior to caudal stings usually dark purplish-brown; and features of the ventral lateral-line canals (hyomandibular canal very narrow, infraorbital and supraorbital canals not undulated, supraorbital and infraorbital loops small and narrow, supraorbital loop very short, not extending posteriorly to level of mouth, jugular and posterior infraorbital canals short, not extending caudally to first gill slits, subpleural loop very narrow posteriorly; absence of anterior and posterior subpleural tubules). To provide a foundation for the description of P. nana sp. nov., morphological variation in P. iwamae was examined based on all type specimens as well as newly collected and previously unreported material. Two specimens topotypic with the male paratype of P. nana sp. nov., referred to here as Plesiotrygon cf. iwamae, are also reported. Relationships of the new species to P. iwamae are discussed; further characters indicative of Plesiotrygon monophyly are proposed, but the genus may still not be valid. Plesiotrygon nana sp. nov., is commercialized with some regularity in the international aquarium trade from Iquitos (Peru), an alarming circumstance because nothing is known of its biology or conservation requirements.
Resumo:
Collections were made every two months in Ilha Grande Bay, Rio de Janeiro, for 21 months (August/2004-May/2006) to study the gametogenesis of Madracis decactis Lyman, 1859. A total of 1800 polyps were examined using standard histological techniques. Madracis decactis is a hermaphroditic species whose male and female gametes develop within different mesenteries. Oogenesis begins in October, while spermatogenesis begins at the end of February, both reaching maturity at the end of April. The peak of reproductive activity occurred between February and April, when all the polyps were fertile, containing mainly stage III oocytes. Examination of fertile polyps indicated the simultaneous presence of stages I, II and III for oogenesis and I, II, III and IV for spermatogenesis. No embryos or planulae were observed in the histological sections. The gametes or planulae spawning may occur between April and May.
Resumo:
Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.
Resumo:
The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.
Resumo:
Os estádios de desenvolvimento dos ovários da lagosta Panulirus echinatus Smith, 1869 foram caracterizados com base nos aspectos macroscópicos, microscópicos e na relação gonadossomática (RGS). Através de amostragem mensal (novembro/1999 a outubro/2000) foram capturadas 711 fêmeas, empregando-se redes de espera de fundo. Retirou-se a região dorsal da carapaça para avaliação dos ovários. Estes foram dissecados, pesados, fixados em solução de Bouin e submetidos aos procedimentos histológicos. A análise microscópica dos ovários foi avaliada pela presença de células germinativas nas diferentes fases de desenvolvimento. Esta análise quando associada a macroscopia (mudança de cor e volume das gônadas no cefalotórax) e a relação gonadossomática (RGS) possibilitou a caracterização de cinco estádios de desenvolvimento: imaturo (I), em desenvolvimento (II), pré-maturação (III), maduro (IV) e pós-desova (V). As análises estatísticas confirmaram que a RGS pode ser utilizada como indicadora dos estádios de maturidade.
Resumo:
Esta pesquisa caracteriza os estádios de desenvolvimento dos testículos e canais deferentes da lagosta Panulirus echinatus Smith, 1869 a partir da relação entre seus aspectos macroscópicos, microscópicos e a relação gonadossomática (RGS). Através de amostragem mensal (novembro de 1999 a outubro de 2000) foram capturados 1716 machos, empregando-se redes de espera de fundo. Retirou-se a região dorsal da carapaça para avaliação dos órgãos reprodutivos. Os testículos e canais deferentes foram dissecados, pesados, fixados em solução de Bouin e submetidos aos procedimentos histológicos. A análise microscópica dos órgãos reprodutivos foi avaliada pela presença ou ausência de espermatozóides nos testículos e canais deferentes. Esta, quando associada a macroscopia (mudança de cor, tamanho, diâmetro e desenvolvimento de espermatóforo) e a relação gonadossomática (RGS), possibilitou a caracterização de três estádios de desenvolvimento: imaturo, intermediário e maturo. Ficou evidenciada que a maturidade dos testículos precedeu a maturidade dos canais deferentes. Para avaliar se a RGS é um bom indicador quantitativo dos estádios de maturidade, um teste t (alfa = 0,05) foi usado e constatou diferença significativa nas médias da RGS. A RGS pode ser utilizada como indicadora dos estádios de maturidade para P. echinatus.
Resumo:
Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.