Effect of diclofenac sodium on the healing process of end-to-end anastomosis in carotid arteries of rabbits. Histopathological and biomechanical studies

Aim. Diclofenac sodium is a non-steroidal anti-inflammatory drug commonly used to attenuate painful inflammatory reactions in surgery. However, it may delay healing in the skin and gastrointestinal tract. The aim of this study was to evaluate the influence of Diclofenac in vascular healing. Methods. Ninety rabbits had their carotid arteries sectioned and reconstructed by end-to-end anastomosis with interrupted sutures. The animals were randomly allocated into 3 groups of 30 each and treated by intramuscular route with saline (control), 5 mg/kg/day of diclofenac sodium (DS-5), and 10 mg/kg/day of diclofenac sodium (DS-10). Treatment began on the day of surgery and lasted 4 days. Angiography, biomechanical properties (failure load, failure elongation, yield point, yield point elongation, and stiffness were obtained from the load/elongation curve), macroscopic and histological examinations (hematoxylin-eosin, Masson, Calleja, Picrossirius-red), and scanning electron microscopy were studied in both arteries on the 3rd and 15th postoperative days. Results. No significant differences in biomechanical properties were observed either in the 3 groups or the experimental times. The carotid artery healing process was similar in the 3 groups. Conclusion. Diclofenac sodium did not cause alterations nor delayed carotid artery healing.

Intraepithelial alterations in the Guinea pig lateral prostate at different ages after estradiol treatment

The prostate is an accessory gland of the mammal reproductive system with great volume and high functional importance. Many works infer that, in addition to the androgenic ones, the estrogen can be associated with benign prostatic hyperplasia and prostatic cancer, but no conclusive evidence exists on the role of estrogen in normal prostatic and neoplastic tissue. The objective of this work was to evaluate the effects of chronic administration of estradiol benzoate on the lateral prostate of guinea pigs in the pre-pubescent, pubescent, post-pubescent and adult phases, with emphasis on the modifications provoked by this hormone on the glandular epithelium. The analyses of the estradiol-treated and control groups were investigated using histological procedures and transmission electron microscopy. The histopathological analysis of the lateral prostate in the treated group revealed areas where epithelial dysplasia was observed, assuming at some places a pattern of epithelial stratification characteristic of prostatic intraepithelial neoplasia. After ultrastructural analysis, the following were observed: enlargement of the internal membranes, heterogeneity in the cellular types, hypertrophy of the basal cells and apparent decrease of cytoplasmic organelles in some cells of the prostatic intraepithelial neoplasia. Still, a loss of cellular polarity was observed, along with nuclei of various forms, sizes and heights - as well as irregular chromatin distribution patterns. Such alterations were found mainly in pubescent, post-pubescent and adult animals subject to the chronic administration of estradiol. These findings reinforce the already existent data in understanding the role of estrogen in the etiology of prostatic diseases.

Experimental infection of commercial layers using a Salmonella enterica sorovar Gallinarum strain: Blood serum components and histopathological changes

The purpose of the study was to evaluate the blood serum components and histopathological findings of commercial layers experimentally infected with Salmonella Gallinarum (SG), the microorganism responsible for the fowl typhoid. 180 commercial layers were distributed into three groups (G): G1 and G2 received 0.2mL of inoculum containing 3.3x10 8 and 3.3x10 5 CFU of resistant SG to the nalidix acid (Nal r)/mL, respectively, directly into their crops; G3 did not receive the inoculum (control group). The birds were inoculated when they were 5 days old and the euthanasia was performed 24 hours before and after infection and 3, 5, 7 and 10 days after the administration of the inoculum. In each day of collection, blood samples were obtained for biochemical tests of the blood serum besides macroscopic and histopathological examination of the birds. Data were submitted to analysis of variance by the SAS statistical program and the means were compared by Tukeýs test (P<0,05). In the serum biochemical profile it was observed that the infection interfered in the values of total protein, albumin, calcium, phosphorus, cholesterol, triglycerides, GGT and ALT in the infected groups. The macroscopic examination showed hepatomegaly, alteration of the hepatic color and hemorrhagic spots in the kidneys of animals from G1. The histopathology showed degeneration of hepatocytes in G1 and G2 although other lesions like multifocal hepatic necrosis and inflammatory infiltrate on the liver and kidneys were restricted to G1. The alterations were more evident on G1 which received a higher concentration of bacteria/mL when compared to G2. The results showed that the correlation between biochemical alterations and macroscopic and histopathological lesions can assist the comprehension of the pathophysiology of fowl typhoid, supplying important information for the diagnosis and prognosis of this disease.

Toxicological and histopathological effects of hydramethylnon on Atta sexdens rubropilosa (Hymenoptera: Formicidae) workers

The leaf-cut ants are important agricultural pest, because they can cause intense defoliation in plants and destroy large areas cultivated. Although there are several works for the control of these insects by examining the toxicity of natural chemical compounds on various species of ants, few are focused on analyses of morphological changes caused in the affected organs. The aim of this study was to evaluate the effects of hydramethylnon on Atta sexdens rubropilosa workers through toxicological bioassays and morphological analysis of the post-pharyngeal glands, midgut, and Malpighian tubules of these ants. Hydramethylnon dissolved either in acetone (HA) or in a mixture of acetone and soy oil (HAO) was added to the artificial diet at a concentration of 200 μg/mL. The workers fed daily with the diet containing hydramethylnon showed higher mortality than the controls, especially when HAO was used. Moreover, light and electron microscopy revealed morphological alterations in the midgut and Malpighian tubules of workers treated with HA, whereas alterations of the post-pharyngeal glands were observed in the HAO-treated group. These results indicated that the presence of soy oil provided an alternate route for the ingestion of the formicide's active ingredient and corroborated previous studies that suggested a role for the post-pharyngeal glands in lipid metabolism. Our findings suggest that the oil may carry hydramethylnon to the gland lumen, resulting in lower quantity of the active ingredient in the intestinal lumen and Malpighian tubules that explains the lower degree of morphological alterations in these structures in the workers treated with HAO. These results may provide insight into the toxicological effects of hydramethylnon on leaf-cutting ants and the use of vegetable oil as an adjuvant in baits to control ants. © 2012 Elsevier Ltd.

Acute Toxicity by Water Containing Hexavalent or Trivalent Chromium in Native Brazilian Fish, Piaractus mesopotamicus: Anatomopathological Alterations and Mortality

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Structural alterations of the bladder induced by detrusor instability. experimental study in rabbits

The aim of this study was to evaluate the histopathological and immunohistochemical alterations induced by detrusor instability in the bladder of rabbits submitted to partial bladder outlet obstruction. Thirty male Norfolk rabbits were divided into 2 groups, a clinical control and a group with detrusor instability. Urine culture, cystometric study, histopathological and immunohistochemical analysis were performed in all animals prior to surgery (M1) and 4 weeks after-surgery (M2). Partial obstruction (G2) resulted in a 2.5 fold increment (p < 0.05) in bladder weight when compared to control (G1). Four weeks after surgery, 93% of animals in G2 developed cystitis. Partial obstruction resulted in detrusor instability at M2 and bladder capacity was significantly increased (p < 0.05) from M1 to M2. The incidence of mild to moderate mucosal and adventitious fibrosis at M2 was higher in G2 (p < 0.05) when compared to G1. Inflammatory reaction at M2 was statistically higher (p < 0.05) in G2. There was no difference in muscular hypertrophy between M1 and M2 in G1. However, 67% of G2 bladders showed a moderate to intense muscular hypertrophy at M2. Hyperplasia of the epithelium was also increased in G2 when M1 and M2 were compared (p < 0.05). Detrusor instability induced by partial bladder outlet obstruction caused significant histopathological and immunohistochemical alterations in the bladder of rabbits.

Lung Age Is Related To Carotid Structural Alterations In Hypertensive Subjects.

Hypertensive patients exhibit higher cardiovascular risk and reduced lung function compared with the general population. Whether this association stems from the coexistence of two highly prevalent diseases or from direct or indirect links of pathophysiological mechanisms is presently unclear. This study investigated the association between lung function and carotid features in non-smoking hypertensive subjects with supposed normal lung function. Hypertensive patients (n = 67) were cross-sectionally evaluated by clinical, hemodynamic, laboratory, and carotid ultrasound analysis. Forced vital capacity, forced expired volume in 1 second and in 6 seconds, and lung age were estimated by spirometry. Subjects with ventilatory abnormalities according to current guidelines were excluded. Regression analysis adjusted for age and prior smoking history showed that lung age and the percentage of predicted spirometric parameters associated with common carotid intima-media thickness, diameter, and stiffness. Further analyses, adjusted for additional potential confounders, revealed that lung age was the spirometric parameter exhibiting the most significant regression coefficients with carotid features. Conversely, plasma C-reactive protein and matrix-metalloproteinases-2/9 levels did not influence this relationship. The present findings point toward lung age as a potential marker of vascular remodeling and indicate that lung and vascular remodeling might share common pathophysiological mechanisms in hypertensive subjects.

Quantitative Proteomic Analysis Reveals Metabolic Alterations, Calcium Dysregulation, And Increased Expression Of Extracellular Matrix Proteins In Laminin α2 Chain-deficient Muscle.

Congenital muscular dystrophy with laminin α2 chain deficiency (MDC1A) is one of the most severe forms of muscular disease and is characterized by severe muscle weakness and delayed motor milestones. The genetic basis of MDC1A is well known, yet the secondary mechanisms ultimately leading to muscle degeneration and subsequent connective tissue infiltration are not fully understood. In order to obtain new insights into the molecular mechanisms underlying MDC1A, we performed a comparative proteomic analysis of affected muscles (diaphragm and gastrocnemius) from laminin α2 chain-deficient dy(3K)/dy(3K) mice, using multidimensional protein identification technology combined with tandem mass tags. Out of the approximately 700 identified proteins, 113 and 101 proteins, respectively, were differentially expressed in the diseased gastrocnemius and diaphragm muscles compared with normal muscles. A large portion of these proteins are involved in different metabolic processes, bind calcium, or are expressed in the extracellular matrix. Our findings suggest that metabolic alterations and calcium dysregulation could be novel mechanisms that underlie MDC1A and might be targets that should be explored for therapy. Also, detailed knowledge of the composition of fibrotic tissue, rich in extracellular matrix proteins, in laminin α2 chain-deficient muscle might help in the design of future anti-fibrotic treatments. All MS data have been deposited in the ProteomeXchange with identifier PXD000978 (http://proteomecentral.proteomexchange.org/dataset/PXD000978).

Anatomical Study Of Minor Alterations In Neonate Vocal Folds.

Minor structural alterations of the vocal fold cover are frequent causes of voice abnormalities. They may be difficult to diagnose, and are expressed in different manners. Cases of intracordal cysts, sulcus vocalis, mucosal bridge, and laryngeal micro-diaphragm form the group of minor structural alterations of the vocal fold cover investigated in the present study. The etiopathogenesis and epidemiology of these alterations are poorly known. To evaluate the existence and anatomical characterization of minor structural alterations in the vocal folds of newborns. 56 larynxes excised from neonates of both genders were studied. They were examined fresh, or defrosted after conservation via freezing, under a microscope at magnifications of 25× and 40×. The vocal folds were inspected and palpated by two examiners, with the aim of finding minor structural alterations similar to those described classically, and other undetermined minor structural alterations. Larynges presenting abnormalities were submitted to histological examination. Six cases of abnormalities were found in different larynges: one (1.79%) compatible with a sulcus vocalis and five (8.93%) compatible with a laryngeal micro-diaphragm. No cases of cysts or mucosal bridges were found. The observed abnormalities had characteristics similar to those described in other age groups. Abnormalities similar to sulcus vocalis or micro-diaphragm may be present at birth.

S-nitrosoglutathione Accelerates Recovery From 5-fluorouracil-induced Oral Mucositis.

Mucositis induced by anti-neoplastic drugs is an important, dose-limiting and costly side-effect of cancer therapy. To evaluate the effect of the topical application of S-nitrosoglutathione (GSNO), a nitric oxide donor, on 5-fluorouracil (5-FU)-induced oral mucositis in hamsters. Oral mucositis was induced in male hamsters by two intraperitoneal administrations of 5-FU on the first and second days of the experiment (60 and 40 mg/kg, respectively) followed by mechanical trauma on the fourth day. Animals received saline, HPMC or HPMC/GSNO (0.1, 0.5 or 2.0 mM) 1 h prior to the 5-FU injection and twice a day for 10 or 14 days. Samples of cheek pouches were harvested for: histopathological analysis, TNF-α and IL-1β levels, immunohistochemical staining for iNOS, TNF-α, IL-1β, Ki67 and TGF-β RII and a TUNEL assay. The presence and levels of 39 bacterial taxa were analyzed using the Checkerboard DNA-DNA hybridization method. The profiles of NO released from the HPMC/GSNO formulations were characterized using chemiluminescence. The HPMC/GSNO formulations were found to provide sustained release of NO for more than 4 h at concentration-dependent rates of 14 to 80 nmol/mL/h. Treatment with HPMC/GSNO (0.5 mM) significantly reduced mucosal damage, inflammatory alterations and cell death associated with 5-FU-induced oral mucositis on day 14 but not on day 10. HPMC/GSNO administration also reversed the inhibitory effect of 5-FU on cell proliferation on day 14. In addition, we observed that the chemotherapy significantly increased the levels and/or prevalence of several bacterial species. Topical HPMC/GSNO accelerates mucosal recovery, reduces inflammatory parameters, speeds up re-epithelization and decreases levels of periodontopathic species in mucosal ulcers.

Genomic Copy Number Alterations Of Primary And Secondary Metastasizing Pleomorphic Adenomas.

Metastasizing pleomorphic adenoma (MPA) is a rare tumour, and its mechanism of metastasis still is unknown. To date, there has been no study on MPA genomics. We analysed primary and secondary MPAs with array comparative genomic hybridization to identify somatic copy number alterations and affected genes. Tumour DNA samples from primary (parotid salivary gland) and secondary (scalp skin) MPAs were subjected to array comparative genomic hybridization investigation, and the data were analysed with NEXUS COPY NUMBER DISCOVERY. The primary MPA showed copy number losses affecting 3p22.2p14.3 and 19p13.3p123, and a complex pattern of four different deletions at chromosome 6. The 3p deletion encompassed several genes: CTNNB1, SETD2, BAP1, and PBRM1, among others. The secondary MPA showed a genomic profile similar to that of the primary MPA, with acquisition of additional copy number changes affecting 9p24.3p13.1 (loss), 19q11q13.43 (gain), and 22q11.1q13.33 (gain). Our findings indicated a clonal origin of the secondary MPA, as both tumours shared a common profile of genomic copy number alterations. Furthermore, we were able to detect in the primary tumour a specific pattern of copy number alterations that could explain the metastasizing characteristic, whereas the secondary MPA showed a more unbalanced genome.

Biochemical And Morphological Alterations In The Achilles Tendon Of Mdx Mice.

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Skeletal alterations associated with the use of bonded rapid maxillary expansion appliance

Bonded maxillary expansion appliances have been suggested to control increases in the vertical dimension of the face after rapid maxillary expansion (RME). However, there is still no consensus in the literature about its real skeletal effects. The purpose of this prospective study was to evaluate, longitudinally, the vertical and sagittal cephalometric alterations after RME performed with bonded maxillary expansion appliance. The sample consisted of 26 children, with a mean age of 8.7 years (range: 6.9-10.9 years), with posterior skeletal crossbite and indication for RME. After maxillary expansion, the bonded appliance was used as a fixed retention for 3.4 months, being replaced by a removable retention subsequently. The cephalometric study was performed onto lateral radiographs, taken before treatment was started, and again 6.3 months after removing the bonded appliance. Intra-group comparison was made using paired t test. The results showed that there were no significant sagittal skeletal changes at the end of treatment. There was a small vertical skeletal increase in five of the eleven evaluated cephalometric measures. The maxilla displaced downward, but it did not modify the facial growth patterns or the direction of the mandible growth. Under the specific conditions of this research, it may be concluded that RME with acrylic bonded maxillary expansion appliance did promote signifciant vertical or sagittal cephalometric alterations. The vertical changes found with the use of the bonded appliance were small and probably transitory, similar to those occurred with the use of banded expansion appliances.

Histopathological evaluation of root canal filling materials for primary teeth

This study aimed to assess the response of apical and periapical tissues of dogs' teeth after root canal filling with different materials. Forty roots from dogs' premolars were prepared biomechanically and assigned to 4 groups filled with: Group I: commercial calcium hydroxide and polyethylene glycol-based paste (Calen®) thickened with zinc oxide; Group II: paste composed of iodoform, Rifocort® and camphorated paramonochlorophenol; Group III: zinc oxide-eugenol cement; Group IV: sterile saline. After 30 days, the samples were subjected to histological processing. The histopathological findings revealed that in Groups I and IV the apical and periapical regions exhibited normal appearance, with large number of fibers and cells and no resorption of mineralized tissues. In Group II, mild inflammatory infiltrate and mild edema were observed, with discrete fibrogenesis and bone resorption. Group III showed altered periapical region and thickened periodontal ligament with presence of inflammatory cells and edema. It may be concluded that the Calen paste thickened with zinc oxide yielded the best tissue response, being the most indicated material for root canal filling of primary teeth with pulp vitality.