The Reverse Balassa–Samuelson Effect in the Euro Zone

The debt crisis of the eurozone revealed a structural problem of the single market. The single currency created a pegged foreign exchange system among the euro member states. Thus, the less competitive countries can not improve their wage competitiveness through devaluation, but are motivated to extend the current consumption as the single central bank rate and the zone stability created cheap debt financing. The paper overviews the process of Reverse Balassa-Samuelson effect to explain the importance of external imbalance in the debt crisis.

Partner selection for reverse logistics centres in green supply chains: a fuzzy artificial immune optimization approach

The design of reverse logistics networks has now emerged as a major issue for manufacturers, not only in developed countries where legislation and societal pressures are strong, but also in developing countries where the adoption of reverse logistics practices may offer a competitive advantage. This paper presents a new model for partner selection for reverse logistic centres in green supply chains. The model offers three advantages. Firstly, it enables economic, environment, and social factors to be considered simultaneously. Secondly, by integrating fuzzy set theory and artificial immune optimization technology, it enables both quantitative and qualitative criteria to be considered simultaneously throughout the whole decision-making process. Thirdly, it extends the flat criteria structure for partner selection evaluation for reverse logistics centres to the more suitable hierarchy structure. The applicability of the model is demonstrated by means of an empirical application based on data from a Chinese electronic equipment and instruments manufacturing company.

Free-stretch-blow Investigation of Poly(ethylene terephthalate) over a Large Process Window

This paper highlights for the first time a full comprehension of the deformation procedure during the injection stretch blow moulding (ISBM) process of poly(ethylene terephthalate) (PET) containers, namely thin-walled rigid bottles. The processes required to form PET bottles are complicated and extensive; any development in understanding the nature of material deformation can potentially improve the bottle optimisation process. Removing the bottle mould and performing free-stretch-blow (FSB) experiments revealed insight into the bottle forming characteristics at various preform temperatures and blowing rates. Process outputs cavity pressure and stretch-rod force were recorded using at instrumented stretch-rod and preform surface strain mapping was determined using a combination of a unique patterning procedure and high speed stereoscopic digital image correlation. The unprecedented experimental analysis reveals that the deformation behaviour varies considerably with contrasting process input parameters. Investigation into the effect on deformation mode, strain rate and final bottle shape provide a basis for full understanding of the process optimisation and therefore how the process inputs may aid development of the preferred optimised container.

Whistleblowing process in Finnish health care

Wrongdoing in health care is harmful action that jeopardizes patient safety and can be targeted at the patient or employees. Wrongdoing can vary from illegal, unethical or unprofessional action to inappropriate behavior in the workplace. Whistleblowing can be considered as a process where wrongdoing is suspected or oberved in health care by health care professionals and disclosed to the party that can influence the wrongful action. Whistleblowing causes severe harm to the whistleblower and to the object of whistleblowing complaint, to their personnel life and working community. The aim of this study was to analyze whistleblowing process in Finnish health care. The overall goal is to raise concern about wrongdoing and whistleblowing in Finnish health care. In this cross-sectional descriptive study the data were collected (n = 397) with probability sampling from health care professionals and members of The Union of Health and Social Care Professionals in Finland Tehy. The data were collected with questionnaire: “Whistleblowing -väärinkäytösten paljastaminen terveydenhuollossa” developed for this study and by using Webropol questionnaire -software during 26.6.-17.7.2015. The data were analyzed statistically. According to the results of this study health care professionals had suspected (67 %) and observed (66 %) wrongdoing in health care, more often than once a month (30%). Mostly were suspected (37 %) and observed (36%) inadequacy of the personnel and least violence toward the patient (3 %). Wrongdoing was whistle blown (suspected 29 %, observed 40 %) primarily inside the organization to the closest supervisor (76 %), face-to-face (88 %). Mostly the whistle was blown on nurses’ wrongdoing (58 %). Whistleblowing act didn’t end the wrongdoing (52 %) and whistleblowing had negative consequences to the whistleblower such as discrimination by the manager (35 %). Respondents with work experience less than ten years (62 %), working in temporary position (75 %) or in management position (88 %) were, more unwilling to blow the whistle. Whistleblowing should be conducted internally, to the closest manager in writing and anonymously. Wrongdoing should be dealt between the parties involved, and written warning should ensue from wrongdoing. According to the results of this study whistleblowing on wrongdoing in health care causes negative consequences to the whistleblower. In future, attention in health care should be paid to preventing wrongdoing and enhancing whistleblowing in order to decrease wrongdoing and lessen the consequences that whistleblowers face after blowing the whistle.

Whistleblowing process in Finnish health care

Wrongdoing in health care is harmful action that jeopardizes patient safety and can be targeted at the patient or employees. Wrongdoing can vary from illegal, unethical or unprofessional action to inappropriate behavior in the workplace. Whistleblowing can be considered as a process where wrongdoing is suspected or oberved in health care by health care professionals and disclosed to the party that can influence the wrongful action. Whistleblowing causes severe harm to the whistleblower and to the object of whistleblowing complaint, to their personnel life and working community. The aim of this study was to analyze whistleblowing process in Finnish health care. The overall goal is to raise concern about wrongdoing and whistleblowing in Finnish health care. In this cross-sectional descriptive study the data were collected (n = 397) with probability sampling from health care professionals and members of The Union of Health and Social Care Professionals in Finland Tehy. The data were collected with questionnaire: “Whistleblowing -väärinkäytösten paljastaminen terveydenhuollossa” developed for this study and by using Webropol questionnaire -software during 26.6.-17.7.2015. The data were analyzed statistically. According to the results of this study health care professionals had suspected (67 %) and observed (66 %) wrongdoing in health care, more often than once a month (30%). Mostly were suspected (37 %) and observed (36%) inadequacy of the personnel and least violence toward the patient (3 %). Wrongdoing was whistle blown (suspected 29 %, observed 40 %) primarily inside the organization to the closest supervisor (76 %), face-to-face (88 %). Mostly the whistle was blown on nurses’ wrongdoing (58 %). Whistleblowing act didn’t end the wrongdoing (52 %) and whistleblowing had negative consequences to the whistleblower such as discrimination by the manager (35 %). Respondents with work experience less than ten years (62 %), working in temporary position (75 %) or in management position (88 %) were, more unwilling to blow the whistle. Whistleblowing should be conducted internally, to the closest manager in writing and anonymously. Wrongdoing should be dealt between the parties involved, and written warning should ensue from wrongdoing. According to the results of this study whistleblowing on wrongdoing in health care causes negative consequences to the whistleblower. In future, attention in health care should be paid to preventing wrongdoing and enhancing whistleblowing in order to decrease wrongdoing and lessen the consequences that whistleblowers face after blowing the whistle.

Design of advanced reverse osmosis and nanofiltration membranes for water purification

Most commercially available reverse osmosis (RO) and nanofiltration (NF) membranes are based on the thin film composite (TFC) aromatic polyamide membranes. However, they have several disadvantages including low resistance to fouling, low chemical and thermal stabilities and limited chlorine tolerance. To address these problems, advanced RO/NF membranes are being developed from polyimides for water and wastewater treatments. The following three projects have resulted from my research. (1) Positively charged and solvent resistant NF membranes. The use of solvent resistant membranes to facilitate small molecule separations has been a long standing industry goal of the chemical and pharmaceutical industries. We developed a solvent resistant membrane by chemically cross-linking of polyimide membrane using polyethylenimine. This membrane showed excellent stability in almost all organic solvents. In addition, this membrane was positively charged due to the amine groups remaining on the surface. As a result, high efficiency (> 95%) and selectivity for multivalent heavy metal removal was achieved. (2) Fouling resistant NF membranes. Antifouling membranes are highly desired for “all” applications because fouling will lead to higher energy demand, increase of cleaning and corresponding down time and reduced life-time of the membrane elements. For fouling prevention, we designed a new membrane system using a coating technique to modify membrane surface properties to avoid adsorption of foulants like humic acid. A layer of water-soluble polymer such as polyvinyl alcohol (PVA), polyacrylic acid (PAA), polyvinyl sulfate (PVS) or sulfonated poly(ether ether ketone) (SPEEK), was adsorbed onto the surface of a positively charged membrane. The resultant membranes have a smooth and almost neutrally charged surface which showed better fouling resistance than both the positively charged NF membranes and commercially available negatively charged NTR-7450 membrane. In addition, these membranes showed high efficiency for removal of multivalent ions (> 95% for both cations and anions). Therefore, these antifouling surfaces can be potentially used for water softening, water desalination and wastewater treatment in a membrane bioreactor (MBR) process. (3) Thermally stable RO membranes. Commercial RO membranes cannot be used at temperature higher than 45°C due to the use of polysulfone substrate, which often limits their applications in industries. We successfully developed polyimides as the membrane substrate for thermally stable RO membranes due to their high thermal resistance. The polyimide-based composite polyamide membranes showed desalination performance comparable to the commercial TFC membrane. However, the key advantage of the polyimide-based membrane is its high thermal stability. As the feed temperature increased from 25oC to 95oC, the water flux increased 5 - 6 times while the salt rejection almost kept constant. This membrane appears to provide a unique solution for hot water desalination and also a feasible way to improve the water productivity by increasing the operating temperature without any drop in salt rejection.

Downstream processing of reverse osmosis brine: Characterisation of potential scaling compounds

Reverse osmosis (RO) brine produced at a full-scale coal seam gas (CSG) water treatment facility was characterized with spectroscopic and other analytical techniques. A number of potential scalants including silica, calcium, magnesium, sulphates and carbonates, all of which were present in dissolved and non-dissolved forms, were characterized. The presence of spherical particles with a size range of 10-1000nm and aggregates of 1-10 microns was confirmed by transmission electron microscopy (TEM). Those particulates contained the following metals in decreasing order: K, Si, Sr, Ca, B, Ba, Mg, P, and S. Characterization showed that nearly one-third of the total silicon in the brine was present in the particulates. Further, analysis of the RO brine suggested supersaturation and precipitation of metal carbonates and sulphates during the RO process should take place and could be responsible for subsequently capturing silica in the solid phase. However, the precipitation of crystalline carbonates and sulphates are complex. X-ray diffraction analysis did not confirm the presence of common calcium carbonates or sulphates but instead showed the presence of a suite of complex minerals, to which amorphous silica and/or silica rich compounds could have adhered. A filtration study showed that majority of the siliceous particles were less than 220nm in size, but could still be potentially captured using a low molecular weight ultrafiltration membrane. © 2015 Elsevier Ltd.

HIV Reverse Transcriptase Fidelity And Inhibition Are Modulated By Divalent Cations In A Concentration-Dependent Manner In Vitro

Human immunodeficiency virus (HIV) rapidly evolves through generation and selection of mutants that can escape drug therapy. This process is fueled, in part, by the presumably highly error prone polymerase reverse transcriptase (RT). Fidelity of polymerases can be influenced by cation co-factors. Physiologically, magnesium (Mg2+) is used as a co-factor by RT to perform catalysis, however, alternative cations including manganese (Mn2+), cobalt (Co2+), and zinc (Zn2+) can also be used. I demonstrate here that fidelity and inhibition of HIV RT can be influenced differently, in vitro, by divalent cations depending on their concentration. The reported mutation frequency for purified HIV RT in vitro is typically in the 10-4 range (per nucleotide addition), making the enzyme several-fold less accurate than most polymerases. Paradoxically, results examining HIV replication in cells indicate an error frequency that is ~10 times lower than the error rate obtained in the test tube. Here, I reconcile, at least in part, these discrepancies by showing that HIV RT fidelity in vitro is in the same range as cellular results, in physiological concentrations of free Mg2+ (~0.25 mM). At low Mg2+, mutation rates were 5-10 times lower compared to high Mg2+ conditions (5-10 mM). Alternative divalent cations also have a concentration-dependent effect on RT fidelity. Presumed promutagenic cations Mn2+ and Co2+ decreases the fidelity of RT only at elevated concentrations, and Zn2+, when present in low concentration, increases the fidelity of HIV-1 RT by ~2.5 fold compared to Mg2+. HIV-1 and HIV-2 RT inhibition by nucleoside (NRTIs) and non-nucleoside RT inhibitors (NNRTIs) in vitro is also affected by the Mg2+ concentration. NRTIs lacking 3'-OH group inhibited both enzymes less efficiently in low Mg2+ than in high Mg2+; whereas inhibition by the “translocation defective RT inhibitor”, which retains the 3ʹ-OH, was unaffected by Mg2+ concentration, suggesting that NRTIs with a 3ʹ-OH group may be more potent than other NRTIs. In contrast, NNRTIs were more effective in low vs. high Mg2+ conditions. Overall, the studies presented reveal strategies for designing novel RT inhibitors and strongly emphasize the need for studying HIV RT and RT inhibitors in physiologically relevant low Mg2+ conditions.

Culturable Bacterial Diversity From A Feed Water Of A Reverse Osmosis System, Evaluation Of Biofilm Formation And Biocontrol Using Phages.

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Obesity Versus Osteoarthritis: Beyond The Mechanical Overload.

Obesity is currently considered a major public health problem in the world, already reaching epidemic characteristics, according to the World Health Organization. Excess weight is the major risk factor associated with various diseases, such as type 2 diabetes mellitus, hypertension, dyslipidemia and osteometabolic diseases, including osteoporosis and osteoarthritis. Osteoarthritis is the most prevalent rheumatic disease and the leading cause of physical disability and reduced quality of life of the population over 65 years. It mainly involves the joints that bear weight - knees and hips. However, along with the cases of obesity, its prevalence is increasing, and even in other joints, such as hands. Thus, it is assumed that the influence of obesity on the development of OA is beyond mechanical overload. The purpose of this review was to correlate the possible mechanisms underlying the genesis and development of these two diseases. Increased fat mass is directly proportional to excessive consumption of saturated fatty acids, responsible for systemic low-grade inflammation condition and insulin and leptin resistance. At high levels, leptin assumes inflammatory characteristics and acts in the articular cartilage, triggering the inflammatory process and changing homeostasis this tissue with consequent degeneration. We conclude that obesity is a risk factor for osteoarthritis and that physical activity and changes in diet composition can reverse the inflammatory and leptin resistance, reducing progression or preventing the onset of osteoarthritis.

[meanings Of The Sickening Process For Patients With Systemic Lupus Erythematosus: A Review Of The Literature.]

Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.

[in Process Citation].

20

Didanosine-loaded Chitosan Microspheres Optimized By Surface-response Methodology: A Modified Maximum Likelihood Classification" Approach Formulation For Reverse Transcriptase Inhibitors."

Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física