An Islanding Detection Method based on Impedance Estimation and Grid Identification for Grid-Tie Distributed Power Generation Systems

Power system policies are broadly on track to escalate the use of renewable energy resources in electric power generation. Integration of dispersed generation to the utility network not only intensifies the benefits of renewable generation but also introduces further advantages such as power quality enhancement and freedom of power generation for the consumers. However, issues arise from the integration of distributed generators to the existing utility grid are as significant as its benefits. The issues are aggravated as the number of grid-connected distributed generators increases. Therefore, power quality demands become stricter to ensure a safe and proper advancement towards the emerging smart grid. In this regard, system protection is the area that is highly affected as the grid-connected distributed generation share in electricity generation increases. Islanding detection, amongst all protection issues, is the most important concern for a power system with high penetration of distributed sources. Islanding occurs when a portion of the distribution network which includes one or more distributed generation units and local loads is disconnected from the remaining portion of the grid. Upon formation of a power island, it remains energized due to the presence of one or more distributed sources. This thesis introduces a new islanding detection technique based on an enhanced multi-layer scheme that shows superior performance over the existing techniques. It provides improved solutions for safety and protection of power systems and distributed sources that are capable of operating in grid-connected mode. The proposed active method offers negligible non-detection zone. It is applicable to micro-grids with a number of distributed generation sources without sacrificing the dynamic response of the system. In addition, the information obtained from the proposed scheme allows for smooth transition to stand-alone operation if required. The proposed technique paves the path towards a comprehensive protection solution for future power networks. The proposed method is converter-resident and all power conversion systems that are operating based on power electronics converters can benefit from this method. The theoretical analysis is presented, and extensive simulation results confirm the validity of the analytical work.

Performance Analysis of 5G based Positioning in Railway Applications

Rail transportation has significant importance in the future world. This importance is tightly bounded to accessible, sustainable, efficient and safe railway systems. Precise positioning in railway applications is essential for increasing railway traffic, train-track control, collision avoidance, train management and autonomous train driving. Hence, precise train positioning is a safety-critical application. Nowadays, positioning in railway applications highly depends on a cellular-based system called GSM-R, a railway-specific version of Global System for Mobile Communications (GSM). However, GSM-R is a relatively outdated technology and does not provide enough capacity and precision demanded by future railway networks. One option for positioning is mounting Global Navigation Satellite System (GNSS) receivers on trains as a low-cost solution. Nevertheless, GNSS can not provide continuous service due to signal interruption by harsh environments, tunnels etc. Another option is exploiting cellular-based positioning methods. The most recent cellular technology, 5G, provides high network capacity, low latency, high accuracy and high availability suitable for train positioning. In this thesis, an approach to 5G-based positioning for railway systems is discussed and simulated. Observed Time Difference of Arrival (OTDOA) method and 5G Positioning Reference Signal (PRS) are used. Simulations run using MATLAB, based on existing code developed for 5G positioning by extending it for Non Line of Sight (NLOS) link detection and base station exclusion algorithms. Performance analysis for different configurations is completed. Results show that efficient NLOS detection improves positioning accuracy and implementing a base station exclusion algorithm helps for further increase.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

On The Consistency Of Monte Carlo Track Structure Dna Damage Simulations.

Monte Carlo track structures (MCTS) simulations have been recognized as useful tools for radiobiological modeling. However, the authors noticed several issues regarding the consistency of reported data. Therefore, in this work, they analyze the impact of various user defined parameters on simulated direct DNA damage yields. In addition, they draw attention to discrepancies in published literature in DNA strand break (SB) yields and selected methodologies. The MCTS code Geant4-DNA was used to compare radial dose profiles in a nanometer-scale region of interest (ROI) for photon sources of varying sizes and energies. Then, electron tracks of 0.28 keV-220 keV were superimposed on a geometric DNA model composed of 2.7 × 10(6) nucleosomes, and SBs were simulated according to four definitions based on energy deposits or energy transfers in DNA strand targets compared to a threshold energy ETH. The SB frequencies and complexities in nucleosomes as a function of incident electron energies were obtained. SBs were classified into higher order clusters such as single and double strand breaks (SSBs and DSBs) based on inter-SB distances and on the number of affected strands. Comparisons of different nonuniform dose distributions lacking charged particle equilibrium may lead to erroneous conclusions regarding the effect of energy on relative biological effectiveness. The energy transfer-based SB definitions give similar SB yields as the one based on energy deposit when ETH ≈ 10.79 eV, but deviate significantly for higher ETH values. Between 30 and 40 nucleosomes/Gy show at least one SB in the ROI. The number of nucleosomes that present a complex damage pattern of more than 2 SBs and the degree of complexity of the damage in these nucleosomes diminish as the incident electron energy increases. DNA damage classification into SSB and DSB is highly dependent on the definitions of these higher order structures and their implementations. The authors' show that, for the four studied models, different yields are expected by up to 54% for SSBs and by up to 32% for DSBs, as a function of the incident electrons energy and of the models being compared. MCTS simulations allow to compare direct DNA damage types and complexities induced by ionizing radiation. However, simulation results depend to a large degree on user-defined parameters, definitions, and algorithms such as: DNA model, dose distribution, SB definition, and the DNA damage clustering algorithm. These interdependencies should be well controlled during the simulations and explicitly reported when comparing results to experiments or calculations.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.