972 resultados para Media Events


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Crime possesses a dual nature deriving from its portrayal in the media leading to duplicity in the act of witnessing crime which by showing reality inevitably transforms it into a different kind of reality. The direct relationship with the Gothic genre is very naturally justified by real crime seeming to replicate fictional crime and vice versa, thus originating various forms of the lack of distinction between reality itself and fictional reality, or between truth and falsehood, which many writers and artists associated with Gothic aesthetics have always relied on, and numerous examples of this can be found in the works of Edgar Poe, Patricia Highsmith, Chuck Palahniuk and many others. While real crime may take the Gothic novel as its prototype, it turns out that nowadays television has taken on this role. Examples of this phenomenon are the recent symptoms of obsessive dependence on TV series such as C.S.I., Criminal Minds, The X Files, The Following and Dexter, showing a tendency for television series to replace Gothic novels, thus revealing a perverse attraction for witnessing violence through the same means that transmit the daily news featuring violent events in different scenarios of war all over the world.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

La cuenca del río Reventado, situada en la vertiente sur del Volcán Irazú, Costa Rica, presenta actualmente un riesgo para la ciudad de Cartago (aproximadamente 30.000 habitantes), especialmente para algunos asentamientos cercanos al río mismo.  Este riesgo consiste, en primer lugar, en un deslizamiento con grandes extensiones en la parte inferior de la cuenca media, el deslizamiento llamado San Blas. Este deslizamiento está formado por la antigua terraza de Banderilla de material de avalanchas holocenas y que fue activado en el comienzo de la década de los setenta por la destrucción de su sostén por la explotación de materiales en tajos. Anteriormente, la última vez en los años 63-65, el riesgo era diferente:Erupciones del Irazú con grandes cantidades de cenizas originaron un cambio violento del régimen hidrológico, intensas lluvias causaron crecidas y avalanchas, profundizando en la cuenca superior los cauces y provocando así deslizamientos. En la cuenca baja estas avalanchas provocan inundaciones y acumulaciones de los abanicos diferentes. Los deslizamientos activados por estos eventos actualmente muestran poca o ninguna actividad, pero el riesgo de repeticiones de estos eventos persiste. SUMMARYThe Rio Reventado watershed, situated in the southern slope of the Irazú volcano, Costa Rica, presents a risk for the town of Cartago (30.000 inhabitants) and specially for some settlements near the river.  In first place, this risk consists of a huge landslide in the lower part of the watershed, the<<San Blas- landslide, which is formed by the labaric material of a Holocene terrace of the Reventado, called <<Banderilla- terrace>>. At the beginning of the seventies this terrace was activated due the explotation of its materials in two quarries.  The risks existing before in this watershed were of an other nature, an example give the events of years 1963-65:A violent hydrologic change in the upper part of the Reventado watershed due to the ashfall of an eruption of the Irazú caused big mudflows whish depend the river beds and thus provoked landslides.  These mud flows caused inundations and accumulations in the lower watershed. Today, the land slides activated in the sixties are stable or semistable, but the risk of repetitions still persists.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Protocols for the generation of dendritic cells (DCs) using serum as a supplementation of culture media leads to reactions due to animal proteins and disease transmissions. Several types of serum-free media (SFM), based on good manufacture practices (GMP), have recently been used and seem to be a viable option. The aim of this study was to evaluate the results of the differentiation, maturation, and function of DCs from Acute Myeloid Leukemia patients (AML), generated in SFM and medium supplemented with autologous serum (AS). DCs were analyzed by phenotype characteristics, viability, and functionality. The results showed the possibility of generating viable DCs in all the conditions tested. In patients, the X-VIVO 15 medium was more efficient than the other media tested in the generation of DCs producing IL-12p70 (p=0.05). Moreover, the presence of AS led to a significant increase of IL-10 by DCs as compared with CellGro (p=0.05) and X-Vivo15 (p=0.05) media, both in patients and donors. We concluded that SFM was efficient in the production of DCs for immunotherapy in AML patients. However, the use of AS appears to interfere with the functional capacity of the generated DCs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study evaluated the effect of surface sealant on the translucency of composite resin immersed in different solutions. The study involved the following materials: Charisma, Fortify and coffee, Coca-Cola®, tea and artificial saliva as solutions. Sixty-four specimens (n = 8) were manufactured and immersed in artificial saliva at 37 ± 1 °C. Samples were immersed in the solutions for three times a day and re-immersed in artificial saliva until the translucency readings. The measurements were carried out at nine times: T1 - 24 hours after specimen preparation, T2 - 24 hours after immersion in the solutions, T3 - 48 hours and T4 to T9 - 7, 14, 21, 30, 60 and 90 days, respectively, after immersion. The translucency values were measured using a JOUAN device. The results were subjected to ANOVA and Tukey's test at 5%. The surface sealant was not able to protect the composite resin against staining, the coffee showed the strongest staining action, followed by tea and regarding immersion time, a significant alteration was noted in the translucency of composite resin after 21 days.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: This study evaluated the influence of light sources and immersion media on the color stability of a nanofilled composite resin. MATERIAL AND METHODS: Conventional halogen, high-power-density halogen and high-power-density light-emitting diode (LED) units were used. There were 4 immersion media: coffee, tea, Coke® and artificial saliva. A total of 180 specimens (10 mm x 2 mm) were prepared, immersed in artificial saliva for 24 h at 37±1ºC, and had their initial color measured with a spectrophotometer according to the CIELab system. Then, the specimens were immersed in the 4 media during 60 days. Data from the color change and luminosity were collected and subjected to statistical analysis by the Kruskall-Wallis test (p<0.05). For immersion time, the data were subjected to two-way ANOVA test and Fisher's test (p<0.05). RESULTS: High-power-density LED (ΔE=1.91) promoted similar color stability of the composite resin to that of the tested halogen curing units (Jet Lite 4000 plus - ΔE=2.05; XL 3000 - ΔE=2.28). Coffee (ΔE=8.40; ΔL=-5.21) showed the highest influence on color stability of the studied composite resin. CONCLUSION: There was no significant difference in color stability regardless of the light sources, and coffee was the immersion medium that promoted the highest color changes on the tested composite resin.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Melatonin (MEL) acts as a powerful scavenger of free radicals and direct gonadal responses to melatonin have been reported in the literature. Few studies, however, have evaluated the effect of MEL during in vitro maturation (IVM) on bovine embryos. This study tested the addition of MEL to maturation medium (MM) with no gonadotropins on nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos. Cumulus-oocyte complexes were aspirated from abattoir ovaries and cultured in MM (TCM-199 medium supplemented with 10% fetal calf serum - FCS) at 39ºC and 5% CO2 in air. After 24 hours of culture in MM with 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH; 10-9 M MEL) or 10-9 M MEL, 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH, the oocytes were stained with Hoechst 33342 to evaluate nuclear maturation rate. After in vitro fertilization and embryo culture, development rates were evaluated and the blastocysts were assessed for DNA damage by Comet assay. There was no effect of melatonin added to the MM, alone or in combination with gonadotropins, on nuclear maturation, cleavage and blastocyst rates. These rates ranged between 88% to 90%, 85% to 88% and 42% to 46%, respectively. The extent of DNA damage in embryos was also not affected by MEL supplementation during IVM. The addition of 10-9 M MEL to the MM failed to improve nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos, but was able to properly substitute for gonadotropins during IVM.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The photocatalytic degradation of phenol in aqueous suspensions of TiO2 under different salt concentrations in an annular reactor has been investigated. In all cases, complete removal of phenol and mineralization degrees above 90% were achieved. The reactor operational parameters were optimized and its hydrodynamics characterized in order to couple mass balance equations with kinetic ones. The photodegradation of the organics followed a Langmuir-Hinshelwood-Hougen-Watson lumped kinetics. From GC/MS analyses, several intermediates formed during oxidation have been identified. The main ones were catechol, hydroquinone, and 3-phenyl-2-propenal, in this order. The formation of negligible concentrations of 4-chlorophenol was observed only in high salinity medium. Acute toxicity was determined by using Artemia sp. as the test organism, which indicated that intermediate products were all less toxic than phenol and a significant abatement of the overall toxicity was accomplished, regardless of the salt concentration.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DNA Microarray was developed to monitor the expression of many genes from Xylella fastidiosa, allowing the side by-side comparison of two situations in a single experiment. The experiments were performed using X. fastidiosa cells grown in two culture media: BCYE and XDM2. The primers were synthesized, spotted onto glass slides and the array was hybridized against fluorescently labeled cDNAs. The emitted signals were quantified, normalized and the data were statistically analyzed to verify the differentially expressed genes. According to the data, 104 genes were differentially expressed in XDM2 and 30 genes in BCYE media. The present study showed that DNA microarray technique efficiently differentiate the expressed genes under different conditions.