The drunkard's looking glass : reflecting a faithful likeness of the drunkard, in sundry very interesting attitudes : with lively representations of the many strange capers which he cuts at different stages of his disease ... /

First edition published in 1812 under title: God's revenge against drunkenness.

Seawater carbonate chemistry and biological processes during experiments with early life stages of the blue mussel Mytilus edulis, 2010

Several experiments have shown a decrease of growth and calcification of organisms at decreased pH levels. There is a growing interest to focus on early life stages that are believed to be more sensitive to environmental disturbances such as hypercapnia. Here, we present experimental data, acquired in a commercial hatchery, demonstrating that the growth of planktonic mussel (Mytilus edulis) larvae is significantly affected by a decrease of pH to a level expected for the end of the century. Even though there was no significant effect of a 0.25-0.34 pH unit decrease on hatching and mortality rates during the first 2 days of development nor during the following 13-day period prior to settlement, final shells were respectively 4.5±1.3 and 6.0±2.3% smaller at pHNBS~7.8 (pCO2~1100-1200 µatm) than at a control pHNBS of ~8.1 (pCO2~460-640 µatm). Moreover, a decrease of 12.0±5.4% of shell thickness was observed after 15d of development. More severe impacts were found with a decrease of ~0.5 pHNBS unit during the first 2 days of development which could be attributed to a decrease of calcification due to a slight undersaturation of seawater with respect to aragonite. Indeed, important effects on both hatching and D-veliger shell growth were found. Hatching rates were 24±4% lower while D-veliger shells were 12.7±0.9% smaller at pHNBS~7.6 (pCO2~1900 µatm) than at a control pHNBS of ~8.1 (pCO2~540 µatm). Although these results show that blue mussel larvae are still able to develop a shell in seawater undersaturated with respect to aragonite, the observed decreases of hatching rates and shell growth could lead to a significant decrease of the settlement success. As the environmental conditions considered in this study do not necessarily reflect the natural conditions experienced by this species at the time of spawning, future studies will need to consider the whole larval cycle (from fertilization to settlement) under environmentally relevant conditions in order to investigate the potential ecological and economical losses of a decrease of this species fitness in the field.

Effect of ocean warming and acidification on the early life stages of subtropical Acropora spicifera

This study investigated the impacts of acidified seawater (pCO2 900 µatm) and elevated water temperature (+3 °C) on the early life history stages of Acropora spicifera from the subtropical Houtman Abrolhos Islands (28°S) in Western Australia. Settlement rates were unaffected by high temperature (27 °C, 250 µatm), high pCO2 (24 °C, 900 µatm), or a combination of both high temperature and high pCO2 treatments (27 °C, 900 µatm). There were also no significant differences in rates of post-settlement survival after 4 weeks of exposure between any of the treatments, with survival ranging from 60 to 70 % regardless of treatment. Similarly, calcification, as determined by the skeletal weight of recruits, was unaffected by an increase in water temperature under both ambient and high pCO2 conditions. In contrast, high pCO2 significantly reduced early skeletal development, with mean skeletal weight in the high pCO2 and combined treatments reduced by 60 and 48 %, respectively, compared to control weights. Elevated temperature appeared to have a partially mitigative effect on calcification under high pCO2; however, this effect was not significant. Our results show that rates of settlement, post-settlement survival, and calcification in subtropical corals are relatively resilient to increases in temperature. This is in marked contrast to the sensitivity to temperature reported for the majority of tropical larvae and recruits in the literature. The subtropical corals in this study appear able to withstand an increase in temperature of 3 °C above ambient, indicating that they may have a wider thermal tolerance range and may not be adversely affected by initial increases in water temperature from subtropical 24 to 27 °C. However, the reduction in skeletal weight with high pCO2 indicates that early skeletal formation will be highly vulnerable to the changes in ocean pCO2 expected to occur over the twenty-first century, with implications for their longer-term growth and resilience.

Size-selective mortality and environmental factors affecting early marine growth during early marine life stages of sub-yearling Chinook salmon in Puget Sound, Washington

Thesis (Master's)--University of Washington, 2016-08

Ingestion rates of Artemia nauplii for different larval stages of Macrobrachium rosenbergii

The functional response between ingestion rate and food concentration was determined for each larval stage of Macrobrachium rosenbergii. Artemia franciscana nauplii were supplied at 2,4, 6, 8, 10 and 12 per milliliter. The nauplii were counted by sight using a Pasteur pipette and transferred to Petri dishes containing 40 ml of brackish water (12 parts per thousand) lying on the top of black plastic. One larva at each stage was individually placed into each Petri dish containing different food density. After 24 h, each larva was removed from the Petri dish and the leftover nauplii were counted. The amount consumed was determined by the difference between the initial and final number of nauplii. Ingestion rate (I) increased as food density (P) increased and was defined by the model I=I-m(1-e(-kP)). The results suggest four levels of ingestion during larval development. The first level includes stages II, III and IV, with average maximum consumption of about 40 nauplii/day; the second level includes stages V and VI, with consumption of approximately 55 nauplii/day; the third level includes stages VII and VIII, with consumption of 80-100 nauplii/day. The fourth level includes stages IX, X and XI, in which the high values for maximum ingestion (Im) exceed the load capacity of the medium. The low values for constant k (that may correspond to the adaptability of the food to prey characteristics, such as, size, mobility, etc.) obtained for stages IX, X and XI indicated that Artemia is not an adequate prey and there is necessity of a supplementary diet. The best relationship between predator and prey seemed to occur during stage IV Results obtained in the present work may subsidize future researches and serve as a guideline for practical considerations of feeding rates. (C) 2003 Elsevier B.V. B.V. All rights reserved.

The Real-life Experience With Cardiovascular Complications In The First Dose Of Fingolimod For Multiple Sclerosis.

Fingolimod is a new and efficient treatment for multiple sclerosis (MS). The drug administration requires special attention to the first dose, since cardiovascular adverse events can be observed during the initial six hours of fingolimod ingestion. The present study consisted of a review of cardiovascular data on 180 patients with MS receiving the first dose of fingolimod. The rate of bradycardia in these patients was higher than that observed in clinical trials with very strict inclusion criteria for patients. There were less than 10% of cases requiring special attention, but no fatal cases. All but one patient continued the treatment after this initial dose. This is the first report on real-life administration of fingolimod to Brazilian patients with MS, and one of the few studies with these characteristics in the world.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Long-term follow-up of an 8-year-old boy with insulinoma as the first manifestation of a familial form of multiple endocrine neoplasia type 1

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Success attitudes of young ophthalmologists in the first decade of their career

PURPOSE: To describe the main success attitudes of young ophthalmologists in the first decade of their career. METHODS: This descriptive study comprised subjects selected from a sample of ophthalmologists who were participating in a congress, using a semi-structured questionnaire. The inclusion criteria were as follows: ophthalmologists under the age of 40 years, within 5-10 years from ophthalmology residency conclusion. The subjects were asked about the three main success attitudes in their personal experience during the first years of ophthalmology practice. After the initial results, the 10 most frequently mentioned attitudes were listed and volunteers were again interviewed to choose, within the latter list, the three main attitudes. RESULTS: Forty-eight ophthalmologists were interviewed, 24 (50%) were male; the mean age was 37 years (SD: 2 years, range: 33-40 years) and the mean time from ophthalmology residency conclusion was 8 years (SD: 1 year, range: 5-10 years). The frequency of such mentioned success attitudes were as follows: to invest in professional updating (22.9%), to have a good relationship with patients and professional partners (18.8%), to prioritize individual and family happiness (12.5%), initially to work in an established group (11.1%), to work in public service (9.7%), to have their own business with a homogeneous group (7.6%), to save money (7.6%), to be ready to resume work (4.2%), to get business administration skills (4.2%), and to have professional insurance (0.7%). CONCLUSIONS: The three main success attitudes consisted in investing in professional updating (22.9%), maintaining a good relationship with patients and professional partners (18.8%), and prioritizing individual and family happiness (12.5%). Although these results should not be generalized, they are helpful not only for those ophthalmologists at the beginning of a career but also those who want to reflect on what to prioritize in their professional practice.

First cases of exclusive paternal care in stink bugs (Hemiptera: Pentatomidae)

We describe paternal care in two pentatomid bugs, Lopadusa (Lopadusa) augur Stål, 1860 and Edessa nigropunctata Berg, 1884. Field and laboratory observations showed that males remain with their eggs and early hatched nymphs, while females abandon the eggs after oviposition. Guarding males defensive behaviors towards their clutches were similar to those described for guarding females of pentatomids. Since there is no detailed information on the internal phylogeny of Pentatomidae, it is not possible to make a robust inference on whether paternal care in L. augur and E. nigropunctata has arisen independently or not. If the latter, the two new cases of paternal care we describe here represent the fifth event of independent evolution of this rare behavioral trait in Heteroptera.

First record of Stygnidae for the state of Espírito Santo and description of a new Protimesius (Arachnida: Opiliones: Laniatores)

Protimesius osvaldoi sp. nov. is described from the Reserva Biológica de Sooretama, state of Espírito Santo, southeastern Brazil, being the first record of Stygnidae from this State and the southernmost record of the family in the Brazilian Atlantic Forest (hitherto, the family was recorded down to Bahia only), extending in 210 km south of the previously known distribution. This is a large species, with armature of leg IV very reduced and penial morphology differing from the closest counterparts mainly in the ventral plate, which recedes deeply at the lateral borders and has the distal margin curved ventrally and by the presence of two small intermediate setae. Protimesius Roewer, 1913 consisted hitherto of 17 species, recorded from northern/northeastern Brazil and Amazonia of adjacent countries. A key is given for the 17 species of Protimesius for which males are known.

First report of Eratyrus mucronatus, Stal, 1859, (Hemiptera, Reduviidae, Triatominae), in the State of Rondônia, Brazil

INTRODUCTION: This paper reports, for the first time, the presence of the Eratyrus mucronatus species in the State of Rondonia, Brazil. METHODS: These specimens were caught by chance in the forest and later they were collected using luminous traps. RESULTS: After finding these specimens, the number of the Triatominae genera in Rondonia rose to four, while its species rose to seven. CONCLUSIONS: Complimentary studies will be conducted in order to allow for clearer understanding the ecology of this arthropod, its possible role in transmitting Chagas' disease and its current geographical distribution.

Isoprenoid biosynthesis in the erythrocytic stages of Plasmodium falciparum

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

A new species of Glaphyropoma: the first subterranean copionodontine catfish and the first occurrence of opercular odontodes in the subfamily (Siluriformes: Trichomycteridae)

A new species of the rare copionodontine genus Glaphyropoma is described from subterranean waters in the Diamantina Plateau, Bahia State, central northeastern Brazil. This is the first troglomorphic species in the subfamily Copionodontinae. It is distinguished from all other copionodontines by the presence of opercular odontodes, and further distinguished from its only congener, G. rodriguesi, by the reduction of dark integumentary pigmentation. The new species shares the single synapomorphy previously proposed for Glaphyropoma, the marked narrowing of the first hypobranchial and indirect character evidence also supports its inclusion in the genus. The presence of opercular odontodes in the new species, in combination with a reviewed hypothesis of sister group relationship between Copionodontinae and Trichogeninae, indicate that the absence of opercular odontodes in previously-known copionodontines is secondary, rather than primitive.

First Record of Culex (Culex) brethesi (Dyar) (Diptera: Culicidae) in Rio Grande do Sul State, Brazil

This is the first record of Culex (Culex) brethesi (Dyar) in Rio Grande do Sul state, Brazil. The species was identified from specimens collected in a sand bar vegetation with the aid of a Nasci's trap, during an expedition for surveillance of the West Nile Virus in July of 2006, in the city of Mostardas, Rio Grande do Sul, Brazil.