447 resultados para Corante lipossolúvel


Relevância:

20.00% 20.00%

Publicador:

Resumo:

DEVELOPMENT AND EVALUATION OF GAS DIFFUSION ELECTRODES (GDE) FOR GENERATION OF H2O2 IN SITU AND THEIR APPLICATION IN THE DEGRADATION OF REACTIVE BLUE 19 DYE. This work reports the development of GDE for electrogeneration of H2O2 and their application in the degradation process of Reactive Blue 19 dye. GDE produced by carbon black with 20% polytetrafluoroethylene generated up to 500 mg L-1 of H2O2 through the electrolysis of acidic medium at -0.8 V vs Ag/AgCl. Reactive Blue 19 dye was degraded most efficiently with H2O2 electrogenerated in the presence of Fe(II) ions, leading to removal of 95% of the original color and 39% of TOC at -0.8 V vs Ag/AgCl.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work reports the development of GDE for electrogeneration of H2O2 and their application in the degradation process of Reactive Blue 19 dye. GDE produced by carbon black with 20% polytetrafluoroethylene generated up to 500 mg L-1 of H2O2 through the electrolysis of acidic medium at -0.8 V vs Ag/AgCl. Reactive Blue 19 dye was degraded most efficiently with H2O2 electrogenerated in the presence of Fe(II) ions, leading to removal of 95% of the original color and 39% of TOC at -0.8 V vs Ag/AgCl.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objetivou-se estudar a qualidade fisiológica de sementes de algodão quando submetidas aos processos de encapsulamento com e sem corante em comparação com as sementes apenas tratadas com fungicidas (carboxin e thiran 200 Sc) e inseticida (pirimiphos methyl) - testemunha. A betoneira grande (capacidade de 40 L) recebeu sementes deslintadas + tratadas para serem submetidas ao processo de encapsulação (coating e finishing) com e sem corante, além de uma testemunha não encapsulada, estabelecendo-se os seguintes tratamentos: 1- sementes deslintadas e tratadas com fungicidas (carboxin e thiran 200 Sc) e inseticidas (pirimiphos methyl) (testemunha); 2- sementes deslintadas, tratadas e encapsuladas (coating e finishing) sem corante; e 3- sementes deslintadas, tratadas e encapsuladas com corante. Foi adotado o delineamento inteiramente casualizado com três tratamentos e quatro repetições. As variáveis analisadas foram percentagem de germinação, comprimento de plântulas e massa de 100 sementes. Observou-se que o processo de recobrimento de sementes de algodão deslintadas, tratadas com fungicidas e inseticida e encapsuladas não ocasiona redução na qualidade fisiológica das sementes, e o uso de corante em sementes encapsuladas não altera a sua qualidade.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo deste trabalho foi avaliar o potencial de uso do resíduo da extração de pigmento de cúrcuma na produção de filmes e coberturas. Para o estudo dos filmes, foram utilizados glicerol e sorbitol como plastificantes e avaliados os efeitos da concentração de farinha de cúrcuma e do plastificante sobre as propriedades mecânicas, solubilidade, permeabilidade ao vapor de água (PVA), molhabilidade, atividade antioxidante, teor de curcuminóides e teor de compostos fenólicos totais utilizando um Delineamento Central Composto Rotacional 22, e os resultados foram avaliados utilizando a metodologia de superfície de resposta (MSR). A concentração de farinha afetou de forma positiva a espessura, PVA e o teor de curcuminóides totais dos filmes plastificados com glicerol e sorbitol. Entretanto, esta variável afetou as propriedades de solubilidade, molhabilidade e teor de compostos fenólicos totais somente dos filmes com glicerol. A concentração de plastificante (glicerol ou sorbitol) afetou significativamente a solubilidade, PVA e molhabilidade de ambos os filmes. Filmes de farinha de cúrcuma com boas propriedades mecânicas, baixa permeabilidade ao vapor de água, alta atividade antioxidante, alto teor de curcuminóides e alto teor de compostos fenólicos totais podem ser produzidos utilizando 27,9 a 30 g glicerol/100 g farinha ou 30 a 42 g sorbitol/100 g farinha e concentração de farinha na faixa de 5% a 6,41%. A cobertura de farinha de cúrcuma contendo 6% de farinha e 30 g glicerol/100 g de farinha foi aplicada em bananas Maçã (Musa acuminata) armazenadas a 27ºC e 65% UR. Assim, foi avaliado o efeito da cobertura na qualidade pós-colheita das bananas em função à suas características físico-químicas como perda de massa, firmeza da polpa, pH, acidez titulável, sólidos solúveis, açúcares redutores e cor da casca. Os resultados mostraram que a cobertura foi eficiente em diminuir a perda de massa, o teor de açúcares redutores, a acidez, a perda da firmeza e a cor da casca principalmente durante a etapa de maturação do fruto. Entretanto, não foi observado grande efeito da cobertura sobre o pH e o teor de sólidos solúveis durante o período estudado. As bananas sem a cobertura tiveram vida útil de 6 dias, enquanto as bananas com cobertura tiveram vida útil de 9 dias.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Terminalia catappa Linn belonging to Combretaceae family, popularly known as castanets, has fruits consists of a fleshy pulp, rounded seed and a very hard shell. The natural pigmentation existing in the fruit of castanet indicates the presence of anthocyanins, phenolic nature components belonging to the group of flavonoids, which have antioxidant activity. This research was conducted with the castanets and aimed to the study of factors influencing the extraction of dyes from its pulp. The extracts were obtained using a reactor enjaquetado by solid-liquid extraction. The factors were evaluated as temperature, time, solvent ratio and pH extraction. Adopting a factorial design of 24 , with 4 repetitions at the central point, the effects of these factors on the extraction process were analyzed using Statistica 7.0 software. The antioxidant activity (AA), the content of phenolic compounds (CFT) and the total monomeric anthocyanin content (AMT) were evaluated as response variables planning. Statistical analysis of the results, the effects that influenced the extraction were different for each response (CFT, AMT and AA). However, the pH was significant for the extraction of all compounds. The kinetic behavior of the dye extraction was also studied for phenolic compounds, monomeric anthocyanins and antioxidant activity, in which the equilibrium was reached after 90 minutes of extraction. To study the stability of anthocyanins temperature was the factor that most influenced the stability, however the concentration and pH also played a part.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Textile industry has been a cause of environmental pollution, mainly due to the generation of large volumes of waste containing high organic loading and intense color. In this context, this study evaluated the electrochemical degradation of synthetic effluents from textile industry containing Methylene Blue (AM) dye, using Ti/IrO2-Ta2O5 and Ti/Pt anodes, by direct and indirect (active chlorine) electrooxidation. We evaluated the influence of applied current density (20, 40 and 60 mA/cm2 ), and the presence of different concentrations of electrolyte (NaCl and Na2SO4), as well as the neutral and alkaline pH media. The electrochemical treatment was conducted in a continuous flow reactor, in which the electrolysis time of the AM 100 ppm was 6 hours. The performance of electrochemical process was evaluated by UV-vis spectrophotometry, chemical oxygen demand (COD) and total organic carbon (TOC). The results showed that with increasing current density, it was possible to obtain 100 % of color removal at Ti/IrO2-Ta2O5 and Ti/Pt electrodes. Regarding the color removal efficiency, increasing the concentration of electrolyte promotes a higher percentage of removal using 0,02 M Na2SO4 and 0,017 M NaCl. Concerning to the aqueous medium, the best color removal results were obtained in alkaline medium using Ti/Pt. In terms of organic matter, 86 % was achieved in neutral pH medium for Ti/Pt; while a 30 % in an alkaline medium. To understand the electrochemical behavior due to the oxygen evolution reaction, polarization curves were registered, determining that the presence of NaCl in the solution favored the production of active chlorine species. The best results in energy consumption and cost were obtained by applying lower current density (20 mA/cm2 ) in 6 hours of electrolysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nesta pesquisa, diferentes amostras de quitosana foram produzidas por diferentes condições de hidrólise alcalina da quitina. A partir das amostras de quitosana foram produzidos filmes,sendo estes aplicados na adsorção do corante têxtil reativo preto 5 e os resultados foram comparados com os dos seus respectivos pós. Os valores das massas molares da quitosana aumentaram em função do aumento do diâmetro da quitina e diminuíram com o aumento da relação de solução NaOH:quitina, da concentração de NaOH e tempo de reação, e ficaram na faixa de 100 a 200 kDa. Um comportamento inverso foi observado para o grau de desacetilação da quitosana, e seus valores variaram de 65 a 95%. Quanto aos filmes biopoliméricos elaborados, os que apresentaram melhores valores quanto as suas propriedades mecânicas e de permeabilidade ao vapor de água foram os filmes produzidos com quitosana de mais elevada massa molar e menor grau de desacetilação. A fim de avaliar o comportamento dos filmes em processos de adsorção, estes foram aplicados na remoção do corante reativo preto 5 (RB5) em diferentes condições de pH (4, 6 e 8). Após, foram escolhidos quatro filmes de quitosana (FQ), com diferentes graus de desacetilação e massas molares, que foram comparados com as quitosanas na forma de pó (PQ) no estudo de adsorção. Este foi realizado sob diversas condições experimentais (pH, temperatura e taxa de agitação) através das isotermas de equilíbrio, da termodinâmica e da cinética. Análises de interação e ciclos de adsorção-dessorção também foram realizados. Verificou-se que PQ e FQ com grau de desacetilação de 95% e massa molar de 100 kDa foram os adsorvente mais adequados, apresentando mais de 99% de remoção do corante RB5 em pH 4,0. Para ambos, PQ e FQ, o modelo de Langmuir foi o mais adequado para representar os dados de equilíbrio. As capacidades máximas de adsorção foram 654,3 e 589,5 mg g-1 para PQ e FQ, respectivamente, obtidos a 298 K. O processo de adsorção foi espontâneo, favorável e exotérmico. A adsorção de RB5 para PQ e FQ seguiu o modelo cinético de Elovich,e ocorreram interações eletrostáticas do PQ-RB5 e do FQ-RB5. Os filmes de quitosana foram reutilizados três vezes, enquanto que a quitosana em pó não pode ser reutilizada.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Na indústria têxtil grandes volumes de efluentes são gerados, os quais são caracterizados por serem coloridos e poluentes , devido à presença de corantes em sua composição. Com a necessidade de descontaminação, diferentes métodos são utilizados no tratamento, sendo um deles, a biossorção. Este consiste na remoção das substâncias tóxicas recorrendo a biossorventes obtidos a partir de resíduos agrícolas e sub-produtos de processos industriais. O objetivo principal deste trabalho foi estudar a remoção do corante Preto Reafix Super 2R em soluções aquosas por meio de biossorção com bagaço de malte. Baseando-se sobretudo no estudo da cinética e equilíbrio entre o biossorvente e o corante. Numa primeira fase foi estudada a influência dos parâmetros operacionais, como a influência do diâmetro médio das partículas do biossorvente, o pH da solução e a velocidade de agitação da solução. Sendo as condições ótimas de biossorção definidas a pH 2, velocidade de agitação de 150 rpm e biomassa sem peneiramento. Posteriormente, ajustaram-se os modelos cinéticos de Pseudo-primeira ordem, Pseudo-segunda ordem e de Difusão intrapartícula aos resultados experimentais obtidos pela cinética de adsorção avaliando também a influência da temperatura no tempo de contato para se alcançar o equilibrio. O modelo de Pseudo-segunda ordem conduziu ao melhor ajuste, com um coeficiente de correlação (R2) de apróximadamente 1. A partir dos testes de equilíbrio realizados com diferentes concentrações de corante, foram ajustadas as isotermas de Langmuir, Freundlich, Tempkin aos resultados experimentais tendo-se obtido parâmetros bastante significativos para o modelo Langmuir, cuja capacidade máxima de remoção (qmax) obtida foi de 40,16 mg.g-1. A análise dos parâmetros termodinâmicos permitiram avaliar que o processo de adsorção ocorre espontaneamente, sendo endotérmico e que ao longo do processo aumenta a aleatoriedade na interface sólido/solução, devido à desorganização do processo em virtude das interações que ocorrem.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This ex vivo study evaluated dentin permeability of the root canal in the apical third of different human groups of teeth. Eighty teeth were used, 8 from each dental group: maxillary and mandibular central incisors, lateral incisors and canines, maxillary first premolars (buccal and palatal roots), mandibular first premolars, and maxillary and mandibular second premolars, totalizing 88 roots that were distributed in 11 groups. The root canals were instrumented, irrigated with 1% NaOCl and 15% EDTA. Roots were immersed in 10% copper sulfate for 30 min and then in 1% rubeanic acid alcohol solution for the same period; this chemical reaction reveals dentin permeability by the formation of copper rubeanate, which is a dark-colored compound. Semi-serial 100-µm-thick cross-sections were obtained from the apical third of the roots. Five sections of each apical third were washed, dehydrated, cleared and mounted on glass slides for examination under optical microscopy. The percentage of copper ion infiltration and the amount of tubular dentin were quantified by morphometric analysis. The penetration of copper ions in the apical third ranged from 4.60 to 16.66%. The mandibular central and lateral incisors presented the highest dentin permeability (16.66%), while the maxillary canines and mandibular second and first premolars presented the lowest dentin permeability (4.60%, 4.80% and 5.71%, respectively; p<0.001). The other teeth presented intermediate permeability. In conclusion, dye penetration into dentin tubules at the apical region is strongly dependent on the group of teeth evaluated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A utilização de aloenxerto de nervo conservado em glicerol é uma alternativa a auto-enxertia em casos de lesões de nervos periféricos com perda de substância que diminui a morbidade cirúrgica e provem material suficiente para a reparação neural. O objetivo deste trabalho foi comparar o grau de reparação nervosa, utilizando análises histológica e funcional, através da interposição de enxerto autógeno (grupo A), de tubo de veia conservada em glicerol (grupo B) e de interposição de nervo alógeno conservado em glicerol (grupo C) em defeitos de 5 mm no nervo fibular de ratos Wistar. A análise histológica foi feita após o sacrifício dos animais( 6 semanas) , usando o corante azul de toluidina a 1%. No grupo A (auto-enxerto) verificou-se reação tecidual perineural e escape de fibras axonais mielinizadas para fora dos limites do epineuro que foi maior se comparada ao verificado no Grupo B (Veia autógena + glicerol) e Grupo C (aloenxerto de nervo).A avaliação funcional foi feita através da análise dos padrões das pegadas das patas posteriores dos ratos ("Walking Track Analysis"), nos períodos: pré-operatório, pós-operatório imediato, na terceira e sexta semanas. Na recuperação funcional, não houve diferença estatisticamente significativa entre os três grupos em nenhum dos períodos avaliados.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Electrochemical removals of color and organic load from solutions containing the dye reactive orange 16 (RO16) were performed in an electrochemical flow-cell, using a platinum working electrode. The influence of the process variables flow-rate, such as NaCl concentration, applied potential and solution pH, were studied. The best color removal achieved was 93% (λ = 493 nm) after 60 min at 2.2 V vs. RHE electrolysis, using 1.00 g L-1 NaCl as supporting electrolyte. The rises in the concentration of NaCl and applied potential increased the color removal rate. The best total organic carbon removal (57%) was obtained at 1.8 V, without the separating membrane, indicating that the ideal conditions for the color removal are not necessarily the same as those to remove the total organic carbon. The degradation efficiency decreased with the solution pH decrease.