Perfil sensorial de vinhos brancos varietais brasileiros através de análise descritiva quantitativa

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Phenotypic variability in a family with x-linked adrenoleukodystrophy caused by the p.Trp132Ter mutation

X-linked adrenoleukodystrophy (X-ALD) is an inherited disease with clinical heterogeneity varying from presymptomatic individuals to rapidly progressive cerebral ALD forms. This disease is characterized by increased concentration of very long chain fatty acids (VLCFAs) in plasma and in adrenal, testicular and nervous tissues. Affected individuals can be classified in different clinical settings, according to phenotypic expression and age at onset of initial symptoms. Molecular defects in X-ALD individuals usually result from ABCD1 gene mutations. In the present report we describe clinical data and the ABCD1 gene study in two boys affected with the childhood cerebral form that presented with different symptomatic manifestations at diagnosis. In addition, their maternal grandfather had been diagnosed with Addison's disease indicating phenotypic variation for X-ALD within this family. The mutation p.Trp132Ter was identified in both male patients; additionally, three females, out of eleven family members, were found to be heterozygous after screening for this mutation. In the present report, the molecular analysis was especially important since one of the heterozygous females was in first stages of pregnancy. Therefore, depending on the fetus outcome, if male and p.Trp132Ter carrier, storage of the umbilical cord blood should be recommended as hematopoietic stem cell transplantation could be considered as an option for treatment in the future.

Structural aspects of the p.P222Q homozygous mutation of HSD3B2 gene in a patient with congenital adrenal hyperplasia

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.

Efeito neuromuscular das técnicas fisioterapeuticas bandagem funcional e corrente interferencial na síndrome tensional cervical

Universidade Estadual de Campinas . Faculdade de Educação Física

Qualidade de vida e nivel de atividade fisica de funcionarios de empresa de tecnologia da comunicação

Universidade Estadual de Campinas . Faculdade de Educação Física

Avaliação da aplicação do Metodo Mulligan e massoterapia classica nas disfunções da articulação temporomandibular em mulheres adultas por meio da escala visual-numerica de dor e pelo SF-36

Universidade Estadual de Campinas . Faculdade de Educação Física

Estudo das lesões agudas da ginastica artistica feminina na infancia, a partir da população em treinamento em Campinas, S.P

Universidade Estadual de Campinas. Faculdade de Educação Física

Validação da Body Appreciation Scale (BAS), Life Satisfaction Index for the Third Age (LSITA) e do Aging Perception Questionnaire (APQ) para a língua portuguesa no Brasil : um estudo em idosos brasileiros

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise de biomarcadores sanguíneos em estímulos anaeróbios máximos no nado crawl

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e estrutura fatorial do Body Shape Questionnaire, Body Esteem Scale e Body Appreciation Scale para mulheres brasileiras na meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho em testes de triathlon com diferentes intensidades durante a etapa natação = : Analysis of triathlon trials performance using different intensities during swimming phase

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito da ingestão de cafeina sobre o deficit acumulado de oxigenio, sinal eletromiografico dos musculos superficiais do quadriceps e desempenho fisico de ciclistas

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação e validação da escla ASKAS - Aging Sexual Knowledge and Attitudes Scale em idosos brasileiros

Universidade Estadual de Campinas . Faculdade de Educação Física