Melhoria da atenção aos portadores de hipertensão arterial sistêmica e diabetes mellitus da Unidade de Saúde 24 horas do município de Marechal Candido Rondon/PR

O presente estudo é fruto da análise de uma atividade de intervençãorealizada na Unidade de Saúde 24 horas da cidade de Marechal Cândido Rondon/PR. A intervenção foi proposta pelo Curso de Especialização em Saúde da Família da Universidade Federal de Pelotas. O objetivo principal do estudo foi melhorar a atenção a saúde de adultos portadores de hipertensão arterial sistêmica e/ou diabetes mellitus pertencentes a área de abrangência da referida Unidade. Os dados foram coletados de outubro de 2013 a fevereiro de 2014 através de fichas-espelho, após a coleta os dados foram sistematizados e analisados em planilhas. Os resultados do estudo comprovam a melhoria da atenção aos usuários do serviço de saúde após realização de ações de ampliação da cobertura de atenção como, por exemplo, o acompanhamento de 437 hipertensos residentes na área de cobertura do total de 1.719 hipertensos estimados para a área o que significa um percentual de 25,4%; melhora da adesão do hipertenso e/ou diabético ao programa; realização de exame clínico nos usuários, foi realizado o exame de 309 hipertensos residentes na área de cobertura do total de 437 hipertensos acompanhados na intervenção o que significa um percentual de 70,7%; melhora do registro das informações; mapeamento dos usuários para risco de doença cardiovascular e ações de promoção da saúde. A intervenção apresentou resultados positivos para o serviço de saúde, para a equipe de profissionais e para a comunidade. Houve maior integração entre diferentes setores e profissionais do serviço ao encaminharem usuários para o acompanhamento, ampliou-se a cobertura e a qualidade da atenção aos usuários no sentido da integralidade, as ações passaram a identificar riscos de complicações precocemente e a intervenção foi incorporada à rotina do serviço.

Dyskinesia induced by phenytoin

Phenytoin is an effective antiepileptic drug, although, it can be associated with many side effects, including dyskinesia. OBJECTIVE: To describe the clinical characteristics of phenytoin induced dyskinesia. METHODS: We investigated the occurrence of involuntary movements in patients followed at our adult and pediatric epilepsy clinics during the period of one year. RESULTS: Three patients presented with phenytoin-induced dyskinesia: one adult with axial and orofacial dyskinesia, and two children with choreoathetosis. They did not have other signs of phenytoin intoxication and had complete recovery after phenytoin withdrawal. CONCLUSION: Phenytoin induced dyskinesia may occur during either chronic or initial treatment and with normal serum phenytoin levels. However, it occurs most often in patients on polytherapy, usually after increasing dosage and with toxic serum levels. Other signs of phenytoin intoxication may be present in these patients, but often the dyskinesia is the only side effect, which may delay the diagnosis and treatment. The clinical characteristics of the involuntary movements vary and may be focal or generalized, most often characterized by choreoathetosis and dyskinesias. These may last for hours, days or even years, but frequently disappear completely after phenytoin withdrawal.

Estudo vídeo-polissonográfico em recém-nascidos de termo pequenos para a idade gestacional

Video-polygraphic-EEG studies were performed in the first 24 life-hours of 26 healthy full-term newborns without perinatal injuries. The neurological examination and cranial ultrasonography were normal. The newborns were divided into two groups: one, with full-term appropriate - birth weight 11 newborns (control group ) and the other with full-term low-birth weight 15 newborns. Thirteen newborns of the second group had video-polygraphic-EEG study abnormalities. The most frequent abnormalities were found in 11 cases, as far as sleep architecture is concerned. Also, when compared with the control group, 8 cases of an excessive amount of startles and 2 cases of low behavior activities were found. The results demonstrate the usefulness of video-polygraphic-EEG study in the full-term newborns with intra-uterine growth retard. This examination was sensitive to detect behavior, sleep architecture and EEG standard differences in the low birth-weight newborns as to the control group.

Método para avaliação da conduta visual de lactentes

The purpose of this study is to introduce a method to evaluate visual functions in infants in the first three months of life. An adaptation of the Guide for the Assessment of Visual Ability in Infants (Gagliardo, 1997) was used. The instrument was a ring with string. It was implemented a pilot study with 33 infants, selected according to the following criteria: neonates well enough to go home within two days of birth; 1 to 3 months of chronological age; monthly evaluation with no absence; subjects living in Campinas/SP metropolitan area. In the first month we observed: visual fixation (93,9%); eye contact (90,9%); horizontal tracking (72,7%); inspects surroundings (97,0%). In the third month, we observed: inspects own hands (42,4%) and increased movements of arms (36,4%). This method allowed the evaluation of visual functions in infants, according to the chronological age. Alterations in this function will facilitate immediate referral to medical services for diagnoses.

Reproductive biology of Davilla kunthii A. St-Hil. (Dilleniaceae) in Central Amazonia

This survey aimed at describing the interactions of floral visitors and Davilla kunthii A. St.-Hil. as well as characteristics of its reproductive biology in Itacoatiara, state of Amazonas, Brazil. Tests of the breeding system were performed. The guild of visitors was described according to richness, abundance, relative frequency and constancy. The breeding system tests indicated that D. kunthii is self-compatible. The pollination system was characterized as generalist, with 39 visitor species, from three different orders. Bees were the main group of pollinators, thus some behavioural aspects were described. Th e period of highest foraging activity was between 7 and 10 am. Some species presented agonistic and monopolistic behaviour. Given the behaviour and destructive potential, the Curculionidae seem to have a greater impact as seed predators than pollinators.

Projeto de caixa de madeira para manga (Mangifera Indica L.)

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Atributos mecânicos e erosão por salpicamento em amostras de latossolo vermelho-amarelo sob efeito de vinhaça

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

CROMATOGRAFIA DE AFINIDADE COM CORANTE RED A versus TROCA IÔNICA-PERMEABILIDADE EM GEL: COMPARAÇÃO DA PRATICIDADE NA PURIFICAÇÃO DE ENTEROTOXINA ESTAFILOCÓCICA A

Culture supernatant of Staphylococcus aureus 722 in 3% triptone plus 1% yeast extract was used for EEA purification, proceeding comparison between dye ligand Red A affinity chromatography and classic chromatography. The capture of SEA with Amberlite CG-50 allowed rapid enterotoxin concentration from the culture supernatant. However, the ratio of 15 mg of the resin to a total of 150 mg of the toxin satured the resin, giving only 10 to 30% of SEA recuperation from the supernatant. The elution of concentrated material throught the Red A column resulted in a recovery of 60,87% of the toxin, and required 76 hours, indicating advantage on classic chromatography. Ion exchange column plus gel filtration recovered only 6,5 % of the SEA, and required 114 hours to conclude the procedure. The eletrophoresis of purified SEA indicated high grade of toxin obtained from Red A column, with 90 % of purity, compared to 60 % of classic column.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Topiramate-associated acute, bilateral, angle-closure glaucoma: case report

This paper describes a topiramate induced acute bilateral angle-closure glaucoma. This rare adverse effect is an idiosyncratic reaction characterized by uveal effusion and lens forward displacement, leading to increased intraocular pressure and vision loss. We describe a 55 year-old white woman with migraine, spasmodic torticollis and essential tremor, who developed bilateral acute angle-closure glaucoma, one week after starting topiramate 25 mg/day. She was seen at the Ophthalmology Emergency Department of the Fundação João Penido Burnier (Campinas, SP, Brazil) with a 4 hours history of blurry vision, ocular pain and bright flashes vision. Slit lamp examination revealed moderate conjunctival injection and corneal edema, and shallow anterior chambers. Intraocular pressure was 48 mmHg in both eyes. Fundoscopic examination findings were normal. She was treated with timolol, brimonidine, dorzolamide, pilocarpine, prednisone acetate eye drops and acetazolamide. One hour after those measures, as the intraocular pressure was 30 mmHg, she received a manitol intravenous injection and the intraocular pressure normalized. After 24 hours an iridotomy with Yag laser was performed. Topiramate was discontinued and she was totally recovered after one week.

Efeito neuromuscular das técnicas fisioterapeuticas bandagem funcional e corrente interferencial na síndrome tensional cervical

Universidade Estadual de Campinas . Faculdade de Educação Física

Aspectos da educação do corpo no curriculo de pedagogia

Universidade Estadual de Campinas . Faculdade de Educação Física

As contribuições de Seymour Fisher para os estudos em imagem corporal

Universidade Estadual de Campinas . Faculdade de Educação Física