951 resultados para Field Oriented Control


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organisms<0.4 log CFU/cm(2)). Peracetic acid was the most effective disinfectant, eliminating the multi-species biofilms under all tested conditions (counts of the all microorganisms <0.4 log CFU/cm(2)). In contrast, biguanide was the least effective disinfectant, failing to eliminate biofilms under all the test conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The biofilm formation of Enterococcus faecalis and Enterococcus faecium isolated from the processing of ricotta on stainless steel coupons was evaluated, and the effect of cleaning and sanitization procedures in the control of these biofilms was determined. The formation of biofilms was observed while varying the incubation temperature (7, 25 and 39°C) and time (0, 1, 2, 4, 6 and 8days). At 7°C, the counts of E. faecalis and E. faecium were below 2log10CFU/cm(2). For the temperatures of 25 and 39°C, after 1day, the counts of E. faecalis and E. faecium were 5.75 and 6.07log10CFU/cm(2), respectively, which is characteristic of biofilm formation. The tested sanitation procedures a) acid-anionic tensioactive cleaning, b) anionic tensioactive cleaning+sanitizer and c) acid-anionic tensioactive cleaning+sanitizer were effective in removing the biofilms, reducing the counts to levels below 0.4log10CFU/cm(2). The sanitizer biguanide was the least effective, and peracetic acid was the most effective. These studies revealed the ability of enterococci to form biofilms and the importance of the cleaning step and the type of sanitizer used in sanitation processes for the effective removal of biofilms.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The layer-by-layer technique has been used as a powerful method to produce multilayer thin films with tunable properties. When natural polymers are employed, complicated phenomena such as self-aggregation and fibrilogenesis can occur, making it more difficult to obtain and characterize high-quality films. The weak acid and base character of such materials provides multilayer systems that may differ from those found with synthetic polymers due to strong self-organization effects. Specifically, LbL films prepared with chitosan and silk fibroin (SF) often involve the deposition of fibroin fibrils, which can influence the assembly process, surface properties, and overall film functionality. In this case, one has the intriguing possibility of realizing multilayer thin films with aligned nanofibers. In this article, we propose a strategy to control fibroin fibril formation by adjusting the assembly partner. Aligned fibroin fibrils were formed when chitosan was used as the counterpart, whereas no fibrils were observed when poly(allylamine hydrochloride) (PAH) was used. Charge density, which is higher in PAH, apparently stabilizes SF aggregates on the nanometer scale, thereby preventing their organization into fibrils. The drying step between the deposition of each layer was also crucial for film formation, as it stabilizes the SF molecules. Preliminary cell studies with optimized multilayers indicated that cell viability of NIH-3T3 fibroblasts remained between 90 and 100% after surface seeding, showing the potential application of the films in the biomedical field, as coatings and functional surfaces.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the effects of radiotherapy on salivary BPIFA expression and to investigate the role of BPIFA in the development of known radiotherapy side effects. Unstimulated whole-mouth saliva was collected from 45 cancer patients (1 week before treatment, during the treatment, and 1 week after completion of radiotherapy) and from 20 controls. BPIFA1 and BPIFA2 expression was detected by western blotting and analyzed along with clinicopathologic data and side effects from the radiotherapy. A facial radiation field was associated with lower salivary flow during and after radiotherapy and correlated with side effects, mainly mucositis. Salivary BPIFA1 expression levels were similar between the control group and the patient group before treatment. On the other hand, BPIFA2 levels were higher in the patient group before treatment compared with the control group. BPIFA concentration was modified by radiotherapy as BPIFA1 levels increased (P = .0081) and BPIFA2 decreased (P < .0001). Higher levels of BPIFA1 were associated with the presence of mucositis (P = .0363) and its severity (P = .0500). The present study found that levels of BPIFA1 and glycosylated forms of BPIFA2 are affected by radiotherapy, suggesting that these proteins may play a role in the oral microenvironment in irradiated patients with head and neck cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nitric oxide ( NO) is a substance that acts as a second-messenger and is associated with a number of important physiological functions such as regulation of the vascular tonus, immune modulation and neurotransmission. As a physiological mediator, alteration of its concentration level may cause pathophysiological disfunctions such as hypertension, septic shock and impotence. Possible therapeutic approaches are being developed to control NO levels in vivo. We review herein the main physical and chemical properties of NO, its biological functions and available chemical interventions to reduce and increment its physiological concentration levels. Recent developments in the field are also highlighted.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física