Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Loss of heterozygosity of the APC gene in oral squamous cell carcinoma

The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Effect of IIb-IIIa Glycoprotein Inhibitors in a Partial Limb Amputation Model Submitted to Warm Ischemia in Rats

Viability and functional results of a segment replantation depend on the prevention of deleterious effects of ischemia. Prolonged ischemia leads to alterations in the microcirculation: thrombosis, edema, production of oxygen free radicals, and platelet aggregation. The effect of IIb-IIIa glycoprotein inhibitors was tested in a partial limb amputation model submitted to warm ischemia. The male Wistar rats were divided into four groups: G1 with 0 hours of ischemia and saline (n = 20), G2 with 6 hours of ischemia and saline (n = 24), G3 with 6 hours of ischemia and abciximab (n = 23), and G4 with 6 hours of ischemia and tirofiban (n = 29). The limbs were observed for 7 days and classified as viable or nonviable. Viability, and mortality rates were obtained and analyzed by Q-square and Fisher exact tests (p < 0.05). The viability rates were 100% (G1), 30% (G2), 77.78% (G3), and 80.95% (G4). G2 was statistically different from G1, G3, and G4. G1, G3, and G4 were not statistically different. Transoperative and postoperative mortalities were not statistically different. The administration of abciximab and tirofiban improved limb salvage after ischemia and reperfusion and did not modify mortality rates significantly.

Mutations of the thyroglobulin gene and its relevance to thyroid disorders

Purpose of review To perform an update review on thyroglobulin gene mutations associated with congenital hypothyroidism, thyroid cancer, and autoimmunity. Recent findings Forty-two thyroglobulin mutations have been identified in dyshormonogenetic congenital hypothyroidism. Clinical and laboratory criteria defining defective thyroglobulin synthesis are mostly related to thyroglobulin mutations, generally caused by intracellular thyroglobulin transport defects to the colloid rather than defects in thyroid hormones synthesis. Some mutated thyroglobulin may escape the rigorous chaperone control and reach the colloid, allowing a wide phenotypic spectrum that includes euthyroidism in an adequate iodine environment. In some patients, continuous levothyroxine treatment does not reduce elevated serum thyroid-stimulating hormone (TSH) levels that may lead to goiter development. Prenatally, inactive mutant thyroglobulin will not be able to synthesize thyroid hormones and may increase pituitary thyrotroph threshold for thyroid hormone feedback. Congenital goiter is a risk factor for thyroid cancer and some thyroglobulin variants may confer susceptibility to thyroid autoimmunity. Summary Advances in the understanding of thyroglobulin genetic defects and its severity should allow researchers to perform adequate molecular diagnosis, genetic counseling, and intrauterine treatment to prevent subtle deficits in central nervous system development. This knowledge should improve the understanding of physiological functions of the thyroid and influence of nutritional iodine.

The p.A2215D Thyroglobulin Gene Mutation Leads to Deficient Synthesis and Secretion of the Mutated Protein and Congenital Hypothyroidism with Wide Phenotype Variation

Context: Thyroglobulin (TG) is a large glycoprotein and functions as a matrix for thyroid hormone synthesis. TG gene mutations give rise to goitrous congenital hypothyroidism (CH) with considerable phenotype variation. Objectives: The aim of the study was to report the genetic screening of 15 patients with CH due to TG gene mutations and to perform functional analysis of the p. A2215D mutation. Design: Clinical evaluation and DNA sequencing of the TG gene were performed in all patients. TG expression was analyzed in the goitrous tissue of one patient. Human cells were transfected with expression vectors containing mutated and wild-type human TG cDNA. Results: All patients had an absent rise of serum TG after stimulation with recombinant human TSH. Sequence analysis revealed three previously described mutations (p. A2215D, p. R277X, and g. IVS30 + 1G > T), and two novel mutations (p. Q2142X and g. IVS46-1G > A). Two known (g. IVS30 + 1G/p. A2215D and p. A2215D/p. R277X) and one novel (p. R277X/g. IVS46-1G > A) compound heterozygous constellations were also identified. Functional analysis indicated deficiency in TG synthesis, reduction of TG secretion, and retention of the mutant TG within the cell, leading to an endoplasmic reticulum storage disease, whereas small amounts of mutant TG were still secreted within the cell system. Conclusion: All studied patients were either homozygous or heterozygous for TG gene mutations. Two novel mutations have been detected, and we show that TG mutation p. A2215D promotes the retention of TG within the endoplasmic reticulum and reduces TG synthesis and secretion, causing mild hypothyroidism. In the presence of sufficient iodine supply, some patients with TG mutations are able to compensate the impaired hormonogenesis and generate thyroid hormone. (J Clin Endocrinol Metab 94: 2938-2944, 2009)

Mutational analysis of the necdin gene in patients with congenital isolated hypogonadotropic hypogonadism

Context: Necdin activates GNRH gene expression and is fundamental for the development, migration, and axonal extension of murine GNRH neurons. In humans, necdin plays a potential role in the hypogonadotropic hypogonadism phenotype in patients with Prader-Willi syndrome. Aim: To investigate necdin gene (NDN) variants in patients with isolated hypogonadotropic hypogonadism (IHH). Patients and methods: We studied 160 Brazilian patients with IHH, which includes 92 with Kallmann syndrome and 68 with normosmic IHH. Genomic DNA was extracted and the single NDN exon was amplified and sequenced. To measure GNRH transcriptional activity, luciferase reporter plasmids containing GNRH regulatory regions were transiently transfected into GT1-7 cells in the presence and absence of overexpressed wild-type or mutant necdin. Results: A heterozygous variant of necdin, p.V318A, was identified in a 23-year-old male with Kallmann syndrome. The p.V318A was also present in affected aunt and his father and was absent in 100 Brazilian control subjects. Previous FGFR1 gene analysis revealed a missense mutation (p.P366L) in this family. Functional studies revealed a minor difference in the activation of GNRH transcription by mutant protein compared with wild type in that a significant impairment of the necdin protein activity threshold was observed. Conclusion: A rare variant of necdin (p.V318A) was described in a family with Kallmann syndrome associated with a FGFR1 mutation. Familial segregation and in vitro analysis suggested that this non-synonymous variant did not have a direct causative role in the hypogonadism phenotype. NDN mutations are not a frequent cause of congenital IHH.

Heterozygosity for the S180L Variant of MAL/TIRAP, a Gene Expressing an Adaptor Protein in the Toll-Like Receptor Pathway, Is Associated with Lower Risk of Developing Chronic Chagas Cardiomyopathy

Background. Chagas disease is caused by the protozoan parasite Trypanosoma cruzi. Among T. cruzi-infected individuals, only a subgroup develops severe chronic Chagas cardiomyopathy (CCC); the majority remain asymptomatic. T. cruzi displays numerous ligands for the Toll-like receptors (TLRs), which are an important component of innate immunity that lead to the transcription of proinflammatory cytokines by nuclear factor-kappa B. Because proinflammatory cytokines play an important role in CCC, we hypothesized that single-nucleotide polymorphisms (SNPs) in the genes that encode proteins in the TLR pathway could explain differential susceptibility to CCC among T. cruzi-infected individuals. Methods. For 169 patients with CCC and 76 T. cruzi-infected, asymptomatic individuals, we analyzed SNPs by use of polymerase chain reaction-restriction fragment length polymorphism analysis for the genes TLR1, TLR2, TLR4, TLR5, TLR9, and MAL/TIRAP, which encodes an adaptor protein. Results. Heterozygous carriers of the MAL/TIRAP variant S180L were more prevalent in the asymptomatic group (24 [32%] of 76 subjects) than in the CCC group (21 [12%] of 169) (chi(2) = 12.6; P = .0004 [adjusted P (P(c)) = .0084]; odds ratio [OR], 0.31 [95% confidence interval {CI}, 0.16-0.60]). Subgroup analysis showed a stronger association when asymptomatic patients were compared with patients who had severe CCC (i.e., patients with left-ventricular ejection fraction <= 40%) (chi(2) = 11.3; P = .0008 [P(c) = .017]; OR, 0.22 [95% CI, 0.09-0.56]) than when asymptomatic patients were compared with patients who had mild CCC (i.e., patients with left-ventricular ejection fraction >40%) (chi(2) = 7.7; P = .005 [P(c) = .11]; OR, 0.33 [95% CI, 0.15-0.73]). Conclusion. T. cruzi-infected individuals who are heterozygous for the MAL/TIRAP S180L variant that leads to a decrease in signal transduction upon ligation of TLR2 or TLR4 to their respective ligand may have a lower risk of developing CCC.

Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR alpha transcriptional factors

Lima GA, Anhe GF, Giannocco G, Nunes MT, Correa-Giannella ML, Machado UF. Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR alpha transcriptional factors. Am J Physiol Endocrinol Metab 296: E132-E138, 2009. First published October 28, 2008; doi: 10.1152/ajpendo.90548.2008.-Skeletal muscle is a target tissue for approaches that can improve insulin sensitivity in insulin-resistant states. In muscles, glucose uptake is performed by the GLUT-4 protein, which is encoded by the SLC2A4 gene. SLC2A4 gene expression increases in response to conditions that improve insulin sensitivity, including chronic exercise. However, since chronic exercise improves insulin sensitivity, the increased SLC2A4 gene expression could not be clearly attributed to the muscle contractile activity per se and/or to the improved insulin sensitivity. The present study was designed to investigate the role of contractile activity per se in the regulation of SLC2A4 gene expression as well as in the participation of the transcriptional factors myocyte enhancer factor 2D (MEF2D), hypoxia inducible factor 1a (HIF-1a), and thyroid hormone receptor-alpha (TR alpha). The performed in vitro protocol excluded the interference of metabolic, hormonal, and neural effects. The results showed that, in response to 10 min of electrically induced contraction of soleus muscle, an early 40% increase in GLUT-4 mRNA (30 min) occurred, with a subsequent 65% increase (120 min) in GLUT-4 protein content. EMSA and supershift assays revealed that the stimulus rapidly increased the binding activity of MEF2D, HIF-1a, and TR alpha into the SLC2A4 gene promoter. Furthermore, chromatin immunoprecipitation assay confirmed, in native nucleosome, that contraction induced an approximate fourfold (P < 0.01) increase in MEF2D and HIF-1a-binding activity. In conclusion, muscle contraction per se enhances SLC2A4 gene expression and that involves MEF2D, HIF-1a, and TR alpha transcription factor activation. This finding reinforces the importance of physical activity to improve glycemic homeostasis independently of other additional insulin sensitizer approaches.

Pollymorphisms in the CBS Gene and Homocysteine, Folate and Vitamin B(12) Levels: Association With Polymorphisms in the MTHFR and MTRR Genes in Brazilian Children

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.

Peptides containing T cell epitopes, derived from Sm14, but not from paramyosin, induce a Th1 type of immune response, reduction in liver pathology and partial protection against Schistosoma mansoni infection in mice

Sm14 and paramyosin are two major Schistosoma mansoni vaccine candidate antigens. Recently, we have identified Sm14 and paramyosin epitopes that are recognized by T cells of resistant individuals living in endemic areas for schistosomiasis. Herein, mice were immunized with these peptides separately or in association in order to evaluate their vaccine potential. Immunization of mice with Sm14 peptides alone or mixed with paramyosin peptides was able to induce 26%-36.7% or 28%-29.2% of worm burden reduction, 67% or 46% of intestinal eggs reduction and also 54%-61% or 43%-52% of liver pathology reduction, respectively. Protection was associated with a Th1 type of immune response induced by Sm14 peptide immunization. In contrast, paramyosin peptide vaccination did not engender protective immunity or liver pathology reduction and immunization was associated with a Th2 type of immune response. (C) 2008 Elsevier B.V. All rights reserved.

Cutaneous Mycobacterium haemophilum infection in a kidney transplant recipient after acupuncture treatment

P>Mycobacterium haemophilum is a slow-growing nontuberculous mycobacterium that can cause disease in both immunocompetent and immunocompromised patients. The most common clinical presentations of infection are the appearance of suppurative and ulcerated skin nodules. For the diagnosis, samples collected from suspected cases must be processed under the appropriate conditions, because M. haemophilum requires lower incubation temperatures and iron supplementation in order to grow in culture. In this case report, we describe the occurrence of skin lesions in a kidney transplant recipient, caused by M. haemophilum, associated with acupuncture treatment. The diagnosis was established by direct smear and culture of material aspirated from cutaneous lesions. Species identification was achieved by characterization of the growth requirements and by partial sequencing of the hsp65 gene. The patient was successfully treated with clarithromycin and ciprofloxacin for 12 months. Considering that the number of patients receiving acupuncture treatment is widely increasing, the implications of this potential complication should be recognized, particularly in immunosuppressed patients.

Spectrum and Prevalence of FP/TMEM127 Gene Mutations in Pheochromocytomas and Paragangliomas

Context Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. Objectives To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. Design, Setting, and Participants We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. Main Outcome Measures The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. Results We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P=2.7 x 10(-4)) and/or with familial disease (5 of 20 samples; P=.005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P=.54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Conclusions Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occured in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein. JAMA. 2010;304(23):2611-2619 www.jama.com