971 resultados para PCR‑RFLP


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The influence of apolipoprotein E alleles and genotypes on plasma lipid levels was determined in 185 individuals of mixed ethnicity living in Ouro Preto, Brazil. DNA was obtained from blood samples and the genotypes were determined by an RFLP-PCR procedure. The *3 allele was the most frequent (72%), followed by *4 (20%) and *2 (8%); *4 frequency was higher and *2 frequency was lower in the dyslipidemic group than in the normal control group. The *2 carriers presented lower LDL and total cholesterol levels compared to the *3 and *4 carriers. All six expected genotypes were observed in the individuals genotyped: E2/2 (2.1%), E4/4 (2.7%), E2/4 (3.7%), E2/3 (8.0%), E3/3 (53.3%), E3/4 (29.9%); no difference in genotype frequencies was found between the normal and dyslipidemic groups. Compared with *2, the presence of *3 increases more than two times the risk for dyslipidemia (OR = 2.31; P = 0.025; 95% CI = 1.06-5.06) and the presence of *4 increases it three times (OR = 3.31; P = 0.006; 95% CI = 1.36-8.04). The only significant effect of genotype was an increased risk for dyslipidemia in the *4 genotype carriers (E3/4 + E4/4) compared with the *2 genotype carriers (E2/2 + E2/3) with OR = 3.69 (95% CI = 1.25-10.88). The present study indicates that in the Ouro Preto admixed population the presence of APOE *2 can confer a protective effect, whereas the presence of APOE *4 implies an enhanced risk for dyslipidemia.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Whole blood samples (N = 295) were obtained from different locations in Amazonas and Sucre States, in Venezuela. Malaria was diagnosed by microscopy, OptiMAL™ and polymerase chain reaction (PCR), with Plasmodium vivax, P. falciparum, and P. malariae being detected when possible. We identified 93 infections, 66 of which were caused by P. vivax, 26 by P. falciparum, and 1 was a mixed infection. No infection caused by P. malariae was detected. The sensitivity and specificity of each diagnostic method were high: 95.7 and 97.9% for microscopy, 87.0 and 97.9% for OptiMAL, and 98.0 and 100% for PCR, respectively. Most samples (72.2%) showed more than 5000 parasites/µL blood. The sensitivity of the diagnosis by microscopy and OptiMAL decreased with lower parasitemia. All samples showing disagreement among the methods were reevaluated, but the first result was used for the calculations. Parasites were detected in the 6 false-negative samples by microscopy after the second examination. The mixed infection was only detected by PCR, while the other methods diagnosed it as P. falciparum (microscopy) or P. vivax (OptiMAL) infection. Most of the false results obtained with the OptiMAL strip were related to the P. falciparum-specific band, including 3 species misdiagnoses, which could be related to the test itself or to genetic variation of the Venezuelan strains. The use of the microscopic method for malaria detection is recommended for its low cost but is very difficult to implement in large scale, population-based studies; thus, we report here more efficient methods suitable for this purpose.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Amplification of the MYCN gene in neuroblastomas is a potent biological marker of highly aggressive tumors, which are invariably fatal unless sound clinical management is applied. To determine the usefulness of semi-quantitative differential PCR (SQ-PCR) for accurate quantification of MYCN gene copy number, we evaluated the analytical performance of this method by comparing the results obtained with it for 101 tumor samples of neuroblastoma to that obtained by absolute and relative real-time PCR. Similar results were obtained for 100 (99%) samples, no significant difference was detected between the median log10 MYCN copy number (1.53 by SQ-PCR versus 1.55 by absolute real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). In the comparison of SQ-PCR and relative real-time PCR, SQ-PCR versus relative real-time PCR concordant results were found in 100 (99%) samples, no significant difference was found in median log10 MYCN copy number (1.53 by SQ-PCR versus 1.27 by relative real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). These findings indicate that the performance of SQ-PCR was comparable to that of real-time PCR for the amplification and quantification of MYCN copy number. Thus, SQ-PCR can be reliably used as an alternative assay in laboratories without facilities for real-time PCR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are granulomatous disorders with similar clinical manifestations and pathological features that are often difficult to differentiate. This study evaluated the value of fluorescent quantitative polymerase chain reaction (FQ-PCR) for Mycobacterium tuberculosis (MTB) in fecal samples and biopsy specimens to differentiate ITB from CD. From June 2010 to March 2013, 86 consecutive patients (38 females and 48 males, median age 31.3 years) with provisional diagnoses of ITB and CD were recruited for the study. The patients' clinical, endoscopic, and histological features were monitored until the final definite diagnoses were made. DNA was extracted from 250 mg fecal samples and biopsy tissues from each patient. The extracted DNA was amplified using FQ-PCR for the specific MTB sequence. A total of 29 ITB cases and 36 CD cases were included in the analysis. Perianal disease and longitudinal ulcers were significantly more common in the CD patients (P<0.05), whereas night sweats, ascites, and circumferential ulcers were significantly more common in the ITB patients (P<0.05). Fecal FQ-PCR for MTB was positive in 24 (82.8%) ITB patients and 3 (8.3%) CD patients. Tissue PCR was positive for MTB in 16 (55.2%) ITB patients and 2 (5.6%) CD patients. Compared with tissue FQ-PCR, fecal FQ-PCR was more sensitive (X2=5.16, P=0.02). We conclude that FQ-PCR for MTB on fecal and tissue samples is a valuable assay for differentiating ITB from CD, and fecal FQ-PCR has greater sensitivity for ITB than tissue FQ-PCR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The diagnostic usefulness of Ziehl-Neelsen (ZN)-stained sputum smears combined with conventional polymerase chain reaction (ZN/PCR) to amplify IS6110 region DNA extracted from ZN slides was evaluated. The objective was to verify if this association could improve tuberculosis (TB) diagnosis in patients at remote sites. The study was carried out in 89 patients with culture-confirmed pulmonary TB as defined by the Brazilian Manual for TB Treatment. The participants were recruited in a reference unit for TB treatment in Rondônia, a state in the Amazonian area in northern Brazil. ZN, PCR, and culture performed in the sputum samples from these patients were analyzed in different combinations (i.e., ZN plus PCR and ZN plus culture). The prevalence rates of pulmonary TB in these patients were 32.6 and 28.1% considering culture and ZN/PCR, respectively. The sensitivity and specificity of ZN/PCR were 86 and 93%, respectively. ZN/PCR was able to detect more TB cases than ZN alone. This method could offer a new approach for accurate tuberculosis diagnosis, especially in remote regions of the world where culture is not available.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Salmonelose é a infecção bacteriana de origem alimentar mais freqüente no Paraná, Brasil, e os surtos estão associados, principalmente, ao consumo de ovos, carne de aves e derivados. Os objetivos deste trabalho foram identificar os sorovares de Salmonella isolados de carcaças de frango e caracterizá-los molecularmente por REP e ERIC-PCR, assim como identificar os fagotipos de Salmonella Enteriditis. Dos 25 isolados de Salmonella spp. analisados, 18 foram identificados como Enteriditis, 4 como Braenderup, 2 como Worthington e 1 como infantis. Dos 18 isolados de Enteriditis, 14 foram PT4, 2 PT4a, 1 PT7 e 1 RDNC, por se tratar de colônia rugosa. REP-PCR forneceu padrão eletroforético distinto de 10 a 13 bandas distribuídas entre 120 e 2072 pb para cada sorovar diferente testado. A ERIC-PCR mostrou um padrão de 4 a 5 bandas entre 180 e 1000 pb e foi menos discriminativa quando comparada à REP-PCR. Os resultados encontrados confirmaram que a fagotipagem é uma ferramenta útil e discriminativa para o sorovar Enteriditis. Apesar do pequeno número de sorovares testados, os resultados sugerem que a REP-PCR parece ser um método atrativo a ser utilizado no futuro para a discriminação preliminar de sorovares de Salmonella.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibitors imply that a detection or quantification limit, established for a given method, is restricted to a matrix used during validation and cannot be projected to any other matrix outside the scope of the method. In Brazil, sausage samples were the main class of processed products in which Roundup Ready® (RR) soybean residues were detected. Thus, the validation of methodologies for the detection and quantification of those residues is absolutely necessary. Sausage samples were submitted to two different methods of DNA extraction: modified Wizard and the CTAB method. The yield and quality were compared for both methods. DNA samples were analyzed by conventional and real-time PCR for the detection and quantification of Roundup Ready® soybean in the samples. At least 200 ng of total sausage DNA was necessary for a reliable quantification. Reactions containing DNA amounts below this value led to large variations on the expected GM percentage value. In conventional PCR, the detection limit varied from 1.0 to 500 ng, depending on the GM soybean content in the sample. The precision, performance, and linearity were relatively high indicating that the method used for analysis was satisfactory.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coffee is one of the most appreciated drinks in the world. Coffee ground is obtained from the fruit of a small plant that belongs to the genus Coffea. Coffea arabica and Coffea canephora robusta are the two most commercially important species. They are more commonly known as arabica and robusta, respectively. Two-thirds of Coffea arabica plants are grown in South and Central America, and Eastern Africa - the place of origin for this coffee species. Contamination by microorganisms has been a major matter affecting coffee quality in Brazil, mainly due to the harvesting method adopted. Brazilian harvests are based on fruits collected from the ground mixed with those that fall on collection cloths. As the Bacillus cereus bacterium frequently uses the soil as its environmental reservoir, it is easily capable of becoming a contaminant. This study aimed to evaluate the contamination and potential of B. cereus enterotoxin genes encoding the HBL and NHE complexes, which were observed in strains of ground and roasted coffee samples sold in Rio de Janeiro. The PCR (Polymerase Chain Reaction) results revealed high potential of enterotoxin production in the samples. The method described by Speck (1984) was used for the isolation of contaminants. The investigation of the potential production of enterotoxins through isolates of the microorganism was performed using the B. cereus enterotoxin Reverse Passive Latex Agglutination test-kit (BCET-RPLA, Oxoid), according to the manufacturer's instructions. The potential of enterotoxin production was investigated using polymerase chain reaction (PCR) methods for hblA, hblD and hblC genes (encoding hemolysin HBL) and for nheA, nheB and nheC genes (encoding non-hemolytic enterotoxin - NHE). Of all the 17 strains, 100% were positive for at least 1 enterotoxin gene; 52.9% (9/17) were positive for the 3 genes encoding the HBL complex; 35.3% (6/17) were positive for the three NHE encoding genes; and 29.4% (5/17) were positive for all enterotoxic genes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The enterotoxigenic species Staphylococcus aureus, S. hyicus and S. intermedius show very similar characteristics, making their identification through conventional microbiological methods difficult. This study aimed at the development of a Multiplex PCR (mPCR) for the identification of S. aureus, S. intermedius and S. hyicus using the nuc gene as the target sequence. The results obtained suggest that the set of primers used was specific for the three species of Staphylococcus evaluate with a detection limit of 10² CFU.mL-1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R²) demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct) values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w) were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE). The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB) increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005) increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Maize seeds, infected by Stenocarpella species, are important sources of inoculum for the introduction and dissemination of stalk and ear rot and macrospore leaf spot diseases. The use of healthy seeds is an important strategy for the preventive control of these diseases. However, one of the difficulties in the health quality control programs for maize seeds is the availability of a reliable and quick method for detecting these fungi during routine seed analyses. Therefore, the objective of the present study was to investigate the possibility of using the PCR technique as an alternative method for accurately detecting these pathogens in maize seed samples. Maize seeds were kept in contact with S. maydis colonie developed in PDA media containing mannitol at -1.4 MPa for 72 h. The seed samples used in this study were prepared with infected seeds at incidences of 100, 20, 10, 2, 1 and zero %.The primers used were able to detect S. maydis fungi in association with seeds with a maximum of 2% , however those primers were not able to differentiate between the two species.