961 resultados para CXCL12 rs1801157 polymorphism
Resumo:
The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The aim of this study was to evaluate the frequency of thyroid dysfunction and thyroid antibodies in patients with juvenile onset Systemic Lupus Erythematosus (JOSLE) and its association with clinical and immunological features. Seventy-seven patients with JOSLE, 64 females, median age 19 years, were consecutively enrolled from March to December 2007. Clinical data related to thyroid dysfunction and lupus were obtained by chart review and patient interview. Serum levels of TSH, free T4, anti-thyroglobulin (TgAb), anti-thyroperoxidase (TPOAb), TRAb and lupus related autoantibodies were analyzed by standard techniques. Nine patients were diagnosed as hypothyroidism and 4 hyperthyroidism. 28% JOSLE patients had moderate/high titer of thyroid antibodies: 23% TgAb, 2.6% TPOAb and 3.9% TRAb. JOSLE patients with positive thyroid autoantibodies had higher frequency of anti-U1RNP antibodies than patients without these antibodies (40.9 vs. 14.5%, OR:0.25, CI:0.08-0.76, p = 0.017). Furthermore, renal/neurological/hematological involvement was less frequently observed in patients with hypothyroidism (55.6 vs. 87.5%, OR:0.18, CI:0.04-0.81, p = 0.035) and with thyroid antibodies (68.4 vs. 90.9%, OR:0.22, CI:0.06-0.82. p = 0.027) than in patients without these alterations. No association with PTPN22 polymorphism was found. In conclusion, JOSLE patients have high prevalence of subclinical hypothyroidism. The novel association of anti-thyroid antibodies with anti-U1RNP antibodies in JOSLE seems to identify a subgroup of patients with less life-threatening organ involvement. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Background. Chagas disease is caused by the protozoan parasite Trypanosoma cruzi. Among T. cruzi-infected individuals, only a subgroup develops severe chronic Chagas cardiomyopathy (CCC); the majority remain asymptomatic. T. cruzi displays numerous ligands for the Toll-like receptors (TLRs), which are an important component of innate immunity that lead to the transcription of proinflammatory cytokines by nuclear factor-kappa B. Because proinflammatory cytokines play an important role in CCC, we hypothesized that single-nucleotide polymorphisms (SNPs) in the genes that encode proteins in the TLR pathway could explain differential susceptibility to CCC among T. cruzi-infected individuals. Methods. For 169 patients with CCC and 76 T. cruzi-infected, asymptomatic individuals, we analyzed SNPs by use of polymerase chain reaction-restriction fragment length polymorphism analysis for the genes TLR1, TLR2, TLR4, TLR5, TLR9, and MAL/TIRAP, which encodes an adaptor protein. Results. Heterozygous carriers of the MAL/TIRAP variant S180L were more prevalent in the asymptomatic group (24 [32%] of 76 subjects) than in the CCC group (21 [12%] of 169) (chi(2) = 12.6; P = .0004 [adjusted P (P(c)) = .0084]; odds ratio [OR], 0.31 [95% confidence interval {CI}, 0.16-0.60]). Subgroup analysis showed a stronger association when asymptomatic patients were compared with patients who had severe CCC (i.e., patients with left-ventricular ejection fraction <= 40%) (chi(2) = 11.3; P = .0008 [P(c) = .017]; OR, 0.22 [95% CI, 0.09-0.56]) than when asymptomatic patients were compared with patients who had mild CCC (i.e., patients with left-ventricular ejection fraction >40%) (chi(2) = 7.7; P = .005 [P(c) = .11]; OR, 0.33 [95% CI, 0.15-0.73]). Conclusion. T. cruzi-infected individuals who are heterozygous for the MAL/TIRAP S180L variant that leads to a decrease in signal transduction upon ligation of TLR2 or TLR4 to their respective ligand may have a lower risk of developing CCC.
Resumo:
Context: Micro-RNA have emerged as an important class of short endogenous RNA that act as posttranscriptional regulators of gene expression and are constantly deregulated inhumancancer. MiR-1 has been found down-regulated in lung, colon, and prostate cancer. Objectives: In this study, we investigated the possible role of miR-1 in thyroid carcinogenesis. Design: We have analyzed miR-1 expression in a panel of thyroid neoplasias including benign and malignant lesions and searched for miR-1 targets. Results: Our results show that miR-1 expression is drastically down-regulated in thyroid adenomas and carcinomas in comparison with normal thyroid tissue. Interestingly, miR-1 down-regulation was also found in thyroid hyperproliferative nonneoplastic lesions such as goiters. We identified the CCND2, coding for the cyclin D2 (CCND2) protein that favors the G1/S transition, CXCR4, and SDF-1 alpha genes, coding for the receptor for the stromal cell derived factor-1 (SDF-1)/CXCL12 chemokine and its ligand SDF-1/CXCL12, respectively, as miR-1 targets. An inverse correlation was found between miR-1 expression and CXC chemokine receptor 4 (CXCR4) and SDF-1 alpha protein levels in papillary and anaplastic thyroid carcinomas. Consistent with a role of the CCND2 protein in cell proliferation and CXCR4 and SDF-1 alpha proteins in cell invasion and metastasis, functional studies demonstrate that miR-1 is able to inhibit thyroid carcinoma cell proliferation and migration. Conclusions: These results indicate the involvement of miR-1 in thyroid cell proliferation and migration, validating a role of miR-1 down-regulation in thyroid carcinogenesis. (J Clin Endocrinol Metab 96: E1388-E1398, 2011)
Resumo:
Background: Despite significant advancements in psychopharmacology, treating major depressive disorder (MDD) is still a challenge considering the efficacy, tolerability, safety, and economical costs of most antidepressant drugs. One approach that has been increasingly investigated is modulation of cortical activity with tools of non-invasive brain stimulation - such as transcranial magnetic stimulation and transcranial direct current stimulation (tDCS). Due to its profile, tDCS seems to be a safe and affordable approach. Methods and design: The SELECT TDCS trial aims to compare sertraline vs. tDCS in a double-blinded, randomized, factorial trial enrolling 120 participants to be allocated to four groups to receive sertraline + tDCS, sertraline, tDCS or placebo. Eligibility criteria are moderate-to-severe unipolar depression (Hamilton Depression Rating Scale >17) not currently on sertraline treatment. Treatment will last 6 weeks and the primary outcome is depression change in the Montgomery-Asberg Depression Rating Score (MADRS). Potential biological markers that mediate response, such as BDNF serum levels, Val66Met BDNF polymorphism, and heart rate variability will also be examined. A neuropsychological battery with a focus on executive functioning will be administered. Discussion: With this design we will be able to investigate whether tDCS is more effective than placebo in a sample of patients free of antidepressants and in addition, we will be able to secondarily compare the effect sizes of sertraline vs. tDCS and also the comparison between tDCS and combination of tDCS and sertraline. (C) 2010 Elsevier Inc. All rights reserved.
Resumo:
Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.
Resumo:
Rheumatic fever (RF) is an autoimmune disease caused by the gram-positive bacteria Streptococcus pyogenes that follows a nontreated throat infection in susceptible children. The disease manifests as polyarthritis, carditis, chorea, erythema marginatum, and/or subcutaneous nodules. Carditis, the most serious complication, occurs in 30% to 45% of RF patients and leads to chronic rheumatic heart disease (RHD), which is characterized by progressive and permanent valvular lesions. In this review, we will focus on the genes that confer susceptibility for developing the disease, as well as the innate and adaptive immune responses against S. pyogenes during the acute rheumatic fever episode that leads to RHD autoimmune reactions. The disease is genetically determined, and some human leukocyte antigen class II alleles are involved with susceptibility. Other single nucleotide polymorphisms for TNF-alpha and mannan-binding lectin genes were reported as associated with RF/RHD. T cells play an important role in RHD heart lesions. Several autoantigens were already identified, including cardiac myosin epitopes, vimentin, and other intracellular proteins. In the heart tissue, antigen-driven oligoclonal T cell expansions were probably the effectors of the rheumatic heart lesions. These cells are CD4(+) and produced inflammatory cytokines (TNF alpha and IFN gamma). Molecular mimicry is the mechanism that mediated the cross-reactions between streptococcal antigens and human proteins. The elucidation of chemokines and their receptors involved with the recruitment of Th1, Th2, and Th17 cells, as well as the function of T regulatory cells in situ will certainly contribute to the delineation of the real picture of the heart lesion process that leads to RHD.
Resumo:
Angiotensinogen (AGT) gene polymorphisms have been linked to increased risk of hypertension, but the data remain controversial. In this study we review the most commonly investigated polymorphisms at the AGT locus (other than M235T) and provide summary estimates regarding their association with essential hypertension, while addressing heterogeneity, as well as publication biases. Data on 26 818 subjects from 46 studies for the 4 most-studied AGT variants (T174M in exon 2 and 3 promoter variants: A-6G, A-20C, and G-217A) were meta-analyzed. Statistically significant associations with hypertension were identified for the T174M ( odds ratio [OR]: 1.19; 95% CI: 1.07 to 1.33; P = 0.002) and G-217A (OR: 1.37; 95% CI: 1.17 to 1.59; P = 0.00006) polymorphisms. A dual but consistent effect was observed for the -20C allele, which was associated with a decreased risk of hypertension in populations of mixed and European ancestries (OR: 0.64; 95% CI: 0.44 to 0.92; P = 0.02 and OR: 0.77; 95% CI: 0.65 to 0.91; P = 0.003, respectively), but with a 24% increase in the odds of hypertension in Asian subjects (OR: 1.24; 95% CI: 1.04 to 1.48; P = 0.02). No association of the A-6G variant with hypertension was detected. Current studies support the notion that single variants at the AGT might modulate the risk of hypertension but indicate caution in interpreting these results because of the putative presence of publication bias and gene-environment interactions.
Resumo:
HLA-G is a non-classic Human Leukocyte Antigen (HLA-G) Class I of low polymorphism and restricted tissue distribution that displays tolerogenic functions. In heart transplantation and in combined liver/renal allograft transplantation, the expression of HLA-G has been associated with a lower incidence of acute graft rejection episodes and absence of chronic dysfunction. Since the expression of HLA-G in renal biopsies has been investigated only in few patients who received a combined kidney and liver transplant, in this study we performed a cross-sectional study, systematically comparing the expression of HLA-G in post-transplanted renal grafts, stratifying patients according to the presence or absence of rejection. Patients and Methods: Seventy-three renal specimens (10 with acute rejection and 13 with chronic allograft nephropathy, and 50 with no signs of rejection) were immunohistochemically evaluated for HLA-G expression. Results: In the group as a whole, HLA-G molecules were detected in 40 cases (54.8%). Among specimens that presented HLA-G expression, 2 out of 40 (5%) exhibited acute rejection, 2 (5%) exhibited chronic allograft nephropathy, and the remaining 36 (90%) exhibited no signs of rejection. The comparison between patients with rejection and those without rejection showed that the expression of HLA-G was significantly increased in specimens exhibiting no signs of rejection (p<0.0001). Considering only patients with acute rejection, 8 out of 10 patients showed no HLA-G expression in their kidney biopsies when compared to patients exhibiting no signs of rejection and absence of HLA-G was observed in 14 out of 50 (p=0.0032). Similarly, considering only patients with chronic allograft nephropathy, absence of HLA-G expression was observed in I I out of 13 specimens, whereas in patients without rejection absence of HLA-G was observed in 14 out of 50 (p=0.003). Therapy with tacrolimus was significantly associated with the expression of HLA-G and a better graft prognosis. Conclusions: Our results suggest that HLA-G expression in the kidney allograft and the use of tacrolimus are associated with a lower frequency of acute renal rejection and chronic allograft nephropathy. (c) 2007 Elsevier B.V. All rights reserved.
Resumo:
Introduction: Association between ADAMTS13 levels and cardiovascular events has been described recently. However, no genetic study of ADAMTS13 in coronary patients has been described. Materials and Methods: Based on related populations frequencies and functional studies, we tested three ADAMTS13 polymorphisms: C1342G (Q448E), C1852G (P618A) and C2699T (A900V) in a group of 560 patients enrolled in the Medical, Angioplasty, or Surgery Study II (MASS II), a randomized trial comparing treatments for patients with coronary artery disease (CAD) and preserved left ventricular function. The incidence of the 5-year end-points of death and death from cardiac causes, myocardial infarction, refractory angina requiring revascularization and cerebrovascular accident was determined for each polymorphim`s allele, genotype and haplotype. Risk was assessed with the use of logistic regression and Cox proportional-hazards model and multivariable adjustment was employed for possible confounders. Results: Clinical characteristics and received treatment of each genotype group were similar at baseline. In an adjusted model for cardiovascular risk variables, we were able to observe a significant association between ADAMTS13 900V variant and an increased risk of death (OR: 1,92 CI: 1,14-3,23, p = 0,015) or death from cardiac cause (OR: 2,67, CI: 1,59-4,49, p = 0,0009). No association between events and ADAMTS13 Q448E or P618A was observed. Conclusions: This first report studying the association between ADAMTS13 genotypes and cardiovascular events provides evidence for the association between ADAMTS13 900V variant and an increased risk of death in a population with multi-vessel CAD. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
Objective: Null genotypes of glutathione S-transferase (GSTs) exhibit absence of enzymatic activity and are hypothesized to modulate an increased risk of developing cardiovascular disease. The aim of this study was to identify the potential association between GSTM1 and GSTT1 deleted polymorphisms with cardiovascular risk factors and coronary atherosclerosis in two independent urban populations. Methods and results: Genotype distribution of GSTM1 and GSTT1 deleted polymorphism were examined in a sample of 1577 individuals from the general population and a replication sample of 871 individuals submitted to coronary angiography. Triglycerides, HDL-cholesterol and the triglycerides/HDL ratio were significantly associated with a double-deleted genotype in individuals from the general population. These findings were replicated in a second, independent, population of individuals submitted to coronary angiography. In addition, coronary artery disease severity was also associated with GSTs genotypes and the risk conferred from GSTs genotype was mainly due to triglycerides/HDL ratio information. Conclusions: The data suggest that the presence of a double deletion genotypes of the GSTM1 and GSTT1 genes is associated with hypertriglyceridemia and low HDL-cholesterol levels in humans. These novel findings may provide a new unexplored link between lipid metabolism and GST homeostasis. (C) 2009 Elsevier Ireland Ltd. All rights reserved.
Resumo:
Background: UV radiation is the major environmental factor related to development of cutaneous melanoma. Besides sun exposure and the influence of latitude, some host characteristics such as skin phototype and hair and eye color are also risk factors for melanoma. Polymorphisms in DNA repair genes could be good candidates for susceptibility genes, mainly in geographical regions exposed to high solar radiation. Objective: Evaluate the role of host characteristic.; and DNA repair polymorphism in melanoma risk in Brazil. Methods: We carried out a hospital-based case-control study in Brazil to evaluate the contribution of host factors and polymorphisms in DNA repair to melanoma risk. A total of 412 patients (202 with melanoma and 210 controls) were analyzed regarding host characteristics for melanoma risk as well as for 11 polymorphisms in DNA repair genes. Results: We found an association of host characteristics with melanoma development, such as eye and hair color, fair skin, history of pigmented lesions removed, sunburns in childhood and adolescence, and also European ancestry. Regarding DNA repair gene polymorphisms, we found protection for the XPG 1104 His/His genotype (OR 0.32; 95% CI 0.13-0.75), and increased risk for three polymorphisms in the XPC gene (PAT+; IV-6A and 939Gln), which represent a haplotype for XPC. Melanoma risk was higher in individuals carrying the complete XPC haplotype than each individual polymorphism (OR 3.64; 95% CI 1.77-7.48). Conclusions: Our data indicate that the host factors European ancestry and XPC polymorphisms contributed to melanoma risk in a region exposed to high sun radiation. (C) 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Resumo:
Phytophthora cinnamomi isolates collected from 1977 to 1986 and 1991 to 1993 in two regions in South Africa were analyzed using isozymes. A total of 135 isolates was analyzed for 14 enzymes representing 20 putative loci, of which four were polymorphic. This led to the identification of nine different multilocus isozyme genotypes. Both mating types of P. cinnamomi occurred commonly in the Cape region, whereas, predominantly, the A2 mating type occurred in the Mpumalanga region of South Africa. A2 mating type isolates could be resolved into seven multilocus isozyme genotypes, compared with only two multilocus isozyme genotypes for the A1 mating type isolates. Low levels of gene (0.115) and genotypic (2.4%) diversity and a low number of alleles per locus (1.43) were observed for the South African P. cinnamomi population. The genetic distance between the Cape and Mpumalanga P. cinnamomi populations was relatively low (D-m = 0.165), and no specific pattern in regional distribution of multilocus isozyme genotypes could be observed. The genetic distance between the ''old'' (isolated between 1977 and 1986) and ''new'' (isolated between 1991 and 1993) P. cinnamomi populations from the Cape was low (D-m = 0.164), indicating a stable population over time. Three of the nine multilocus isozyme genotypes were specific to the ''old'' population, and only one multilocus isozyme genotype was specific to the ''new'' population. Significant differences in allele frequencies, a high genetic distance (D-m = 0.581) between the Cape A1 and A2 mating type isolates, significant deviations from Hardy-Weinberg equilibrium, a low overall level of heterozygosity, and a high fixation index (0.71) all indicate that sexual reproduction occurs rarely, if at all, in the South African P. cinnamomi population.
Resumo:
Polymorphisms of chemokines and chemokine-receptors genes have been shown to influence the rate of progression to AIDS; however, their influence on response to HAART remains unclear. We investigated the frequency of the SDF-1-3`A, CCR2-64I, CCR5-D32 and CCR5-Promoter-59029-A/G polymorphisms in Brazilian HIV-1-infected and uninfected individuals and their influence on CD4+ T-cell evolution HIV-1 infected individuals before and during HAART. Polymorphism detection was done in a transversal study of 200 HIV-1-infected and 82 uninfected individuals. The rate of CD4+ T cell increase or decrease was studied in a cohort of 155 HIV-1 infected individuals on pre and post-HAART. Polymorphisms were determined by PCR associated with RFLP. The rate of CD4+ T-cell decline or increase was also determined. HIV-1 infected and uninfected subjects showed, respectively, frequencies of 0.193 and 0.220 for SDF-1-3`A, of 0.140 and 0.110 for CCR2-V64I, of 0.038 and 0.055 for CCR5-D32, and of 0.442 and 0.390 for CCR5-P-59029-A/G. HIV-1-infected subjects carrying one, two or three of these four polymorphisms showed better CD4+ T-cell recovery than HIV-1-infected subjects carrying the four wild-type alleles (+2.7, +1.6, +3.5, and -0.9 lymphocytes/mu l/month, respectively). Regression logistic analysis showed that the CCR5-D32/CCR2-V64I association was predictor of positive CD4+ T cell slope after HAART. The distribution of polymorphisms did not differ between HIV-1-infected and uninfected individuals, but differed from more homogenous ethnic groups probably reflecting the miscegenation of the Brazilian population. We add further evidence of the role of these polymorphisms by showing that the CD4 gain was influenced by carriage of one or more of the polymorphisms studied here. These results highlight the possibility that these genetic traits can be useful to identify patients at risk for faster progression to AIDS or therapeutic failure.