958 resultados para REVERSE TRANSCRIPTION-PCR
Resumo:
Les cellules endothéliales forment une couche semi-perméable entre le sang et les organes. La prolifération, la migration et la polarisation des cellules endothéliales sont essentielles à la formation de nouveaux vaisseaux à partir de vaisseaux préexistants, soit l’angiogenèse. Le facteur de croissance de l’endothélium vasculaire (VEGF) peut activer la synthase endothéliale du monoxyde d’azote (eNOS) et induire la production de monoxyde d’azote (NO) nécessaire pour la régulation de la perméabilité vasculaire et l’angiogenèse. β- caténine est une composante essentielle du complexe des jonctions d’ancrage ainsi qu’un régulateur majeur de la voie de signalisation de Wnt/β-caténine dans laquelle elle se joint au facteur de transcription TCF/LEF et module l’expression de nombreux gènes, dont certains sont impliqués dans l’angiogenèse. La S-nitrosylation (SNO) est un mécanisme de régulation posttraductionnel des protéines par l’ajout d’un groupement nitroso au niveau de résidus cystéines. Le NO produit par eNOS peut induire la S-nitrosylation de la β−caténine au niveau des jonctions intercellulaires et moduler la perméabilité de l’endothélium. Il a d’ailleurs été montré que le NO peut contrôler l’expression génique par la transcription. Le but de cette thèse est d’établir le rôle du NO au sein de la transcription des cellules endothéliales, spécifiquement au niveau de l’activité de β-caténine. Le premier objectif était de déterminer si la SNO de la β-caténine affecte son activité transcriptionnelle. Nous avons montré que le NO inhibe l’activité transcriptionnelle de β- caténine ainsi que la prolifération des cellules endothéliales induites par l’activation de la voie Wnt/β-caténine. Il est intéressant de constater que le VEGF, qui induit la production de NO via eNOS, réprime l’expression de AXIN2 qui est un gène cible de Wnt s’exprimant suite à la i i stimulation par Wnt3a et ce, dépendamment de eNOS. Nous avons identifié que la cystéine 466 de la β-caténine est un résidu essentiel à la modulation répressive de son activité transcriptionnelle par le NO. Lorsqu’il est nitrosylé, ce résidu est responsable de la perturbation du complexe de transcription formé de β-caténine et TCF-4 ce qui inhibe la prolifération des cellules endothéliales induite par la stimulation par Wnt3a. Puisque le NO affecte la transcription, nous avons réalisé l’analyse du transcriptome afin d’obtenir une vue d’ensemble du rôle du NO dans l’activité transcriptionnelle des cellules endothéliales. L’analyse différentielle de l’expression des gènes de cellules endothéliales montre que la répression de eNOS par siRNA augmente l’expression de gènes impliqués au niveau de la polarisation tels que : PARD3A, PARD3B, PKCZ, CRB1 et TJ3. Cette analyse suggère que le NO peut réguler la polarisation des cellules et a permis d’identifier des gènes responsables de l’intégrité des cellules endothéliales et de la réponse immunitaire. De plus, l’analyse de voies de signalisation par KEGG montre que certains gènes modulés par l’ablation de eNOS sont enrichis dans de nombreuses voies de signalisation, notamment Ras et Notch qui sont importantes lors de la migration cellulaire et la différenciation des cellules de têtes et de tronc (tip/stalk). Le regroupement des gènes exprimés chez les cellules traitées au VEGF (déplétées de eNOS ou non) révèle que le NO peut affecter l’expression de gènes contribuant au processus angiogénique, dont l’attraction chimiotactique. Notre étude montre que le NO module la transcription des cellules endothéliales et régule l’expression des gènes impliqués dans l’angiogenèse et la fonction endothéliale.
Resumo:
Les cellules endothéliales forment une couche semi-perméable entre le sang et les organes. La prolifération, la migration et la polarisation des cellules endothéliales sont essentielles à la formation de nouveaux vaisseaux à partir de vaisseaux préexistants, soit l’angiogenèse. Le facteur de croissance de l’endothélium vasculaire (VEGF) peut activer la synthase endothéliale du monoxyde d’azote (eNOS) et induire la production de monoxyde d’azote (NO) nécessaire pour la régulation de la perméabilité vasculaire et l’angiogenèse. β- caténine est une composante essentielle du complexe des jonctions d’ancrage ainsi qu’un régulateur majeur de la voie de signalisation de Wnt/β-caténine dans laquelle elle se joint au facteur de transcription TCF/LEF et module l’expression de nombreux gènes, dont certains sont impliqués dans l’angiogenèse. La S-nitrosylation (SNO) est un mécanisme de régulation posttraductionnel des protéines par l’ajout d’un groupement nitroso au niveau de résidus cystéines. Le NO produit par eNOS peut induire la S-nitrosylation de la β−caténine au niveau des jonctions intercellulaires et moduler la perméabilité de l’endothélium. Il a d’ailleurs été montré que le NO peut contrôler l’expression génique par la transcription. Le but de cette thèse est d’établir le rôle du NO au sein de la transcription des cellules endothéliales, spécifiquement au niveau de l’activité de β-caténine. Le premier objectif était de déterminer si la SNO de la β-caténine affecte son activité transcriptionnelle. Nous avons montré que le NO inhibe l’activité transcriptionnelle de β- caténine ainsi que la prolifération des cellules endothéliales induites par l’activation de la voie Wnt/β-caténine. Il est intéressant de constater que le VEGF, qui induit la production de NO via eNOS, réprime l’expression de AXIN2 qui est un gène cible de Wnt s’exprimant suite à la i i stimulation par Wnt3a et ce, dépendamment de eNOS. Nous avons identifié que la cystéine 466 de la β-caténine est un résidu essentiel à la modulation répressive de son activité transcriptionnelle par le NO. Lorsqu’il est nitrosylé, ce résidu est responsable de la perturbation du complexe de transcription formé de β-caténine et TCF-4 ce qui inhibe la prolifération des cellules endothéliales induite par la stimulation par Wnt3a. Puisque le NO affecte la transcription, nous avons réalisé l’analyse du transcriptome afin d’obtenir une vue d’ensemble du rôle du NO dans l’activité transcriptionnelle des cellules endothéliales. L’analyse différentielle de l’expression des gènes de cellules endothéliales montre que la répression de eNOS par siRNA augmente l’expression de gènes impliqués au niveau de la polarisation tels que : PARD3A, PARD3B, PKCZ, CRB1 et TJ3. Cette analyse suggère que le NO peut réguler la polarisation des cellules et a permis d’identifier des gènes responsables de l’intégrité des cellules endothéliales et de la réponse immunitaire. De plus, l’analyse de voies de signalisation par KEGG montre que certains gènes modulés par l’ablation de eNOS sont enrichis dans de nombreuses voies de signalisation, notamment Ras et Notch qui sont importantes lors de la migration cellulaire et la différenciation des cellules de têtes et de tronc (tip/stalk). Le regroupement des gènes exprimés chez les cellules traitées au VEGF (déplétées de eNOS ou non) révèle que le NO peut affecter l’expression de gènes contribuant au processus angiogénique, dont l’attraction chimiotactique. Notre étude montre que le NO module la transcription des cellules endothéliales et régule l’expression des gènes impliqués dans l’angiogenèse et la fonction endothéliale.
Resumo:
Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Resumo:
Transcription by RNA polymerase can induce the formation of hypernegatively supercoiled DNA both in vivo and in vitro. This phenomenon has been explained by a “twin-supercoiled-domain” model of transcription where a positively supercoiled domain is generated ahead of the RNA polymerase and a negatively supercoiled domain behind it. In E. coli cells, transcription-induced topological change of chromosomal DNA is expected to actively remodel chromosomal structure and greatly influence DNA transactions such as transcription, DNA replication, and recombination. In this study, an IPTG-inducible, two-plasmid system was established to study transcription-coupled DNA supercoiling (TCDS) in E. coli topA strains. By performing topology assays, biological studies, and RT-PCR experiments, TCDS in E. coli topA strains was found to be dependent on promoter strength. Expression of a membrane-insertion protein was not needed for strong promoters, although co-transcriptional synthesis of a polypeptide may be required. More importantly, it was demonstrated that the expression of a membrane-insertion tet gene was not sufficient for the production of hypernegatively supercoiled DNA. These phenomenon can be explained by the “twin-supercoiled-domain” model of transcription where the friction force applied to E. coli RNA polymerase plays a critical role in the generation of hypernegatively supercoiled DNA. Additionally, in order to explore whether TCDS is able to greatly influence a coupled DNA transaction, such as activating a divergently-coupled promoter, an in vivo system was set up to study TCDS and its effects on the supercoiling-sensitive leu-500 promoter. The leu-500 mutation is a single A-to-G point mutation in the -10 region of the promoter controlling the leu operon, and the AT to GC mutation is expected to increase the energy barrier for the formation of a functional transcription open complex. Using luciferase assays and RT-PCR experiments, it was demonstrated that transient TCDS, “confined” within promoter regions, is responsible for activation of the coupled transcription initiation of the leu-500 promoter. Taken together, these results demonstrate that transcription is a major chromosomal remodeling force in E. coli cells.
Resumo:
Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.
Resumo:
G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Human HOX genes encode transcription factors that act as master regulators of embryonic development. They are important in several processes such as cellular morphogenesis and differentiation. The HOXB5 gene in particular has been reported in some types of neoplasm, but not in oral cancer. OBJECTIVE: The present study investigated the expression of HOXB5 in oral squamous cell carcinoma (SCC) and in non-tumoral adjacent tissues, focusing on verifying its possible role as a broad tumor-associated gene and its association with histopathological and clinical (TNM) characteristics. MATERIAL AND METHODS: RT-PCR was performed to amplify HOXB5 mRNA in 15 OSCCs and adjacent non-tumoral epithelium. A possible association with TNM and histopathologic data was verifed by the chi-square and post-hoc t-test. RESULTS: HOXB5 was amplifed in 60% non-tumoral epithelium and in 93.3% carcinomas. No statistically signifcant differences were found regarding the HOXB5 mRNA expression and TNM or histological grade. CONCLUSION: HOXB5 is expressed in OSCCs and its role in cancer progression should be further investigated.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
Melipona quadrifasciata quadrifasciata and M. quadrifasciata anthidioides are subspecies of M. quadrifasciata, a stingless bee species common in coastal Brazil. These subspecies are discriminated by the yellow stripe pattern of the abdominal tergites. We found Vsp I restriction patterns in the cytochrome b region closely associated to each subspecies in 155 M. quadrifasciata colonies of different geographical origin. This mitochondrial DNA molecular marker facilitates diagnosis of M. quadrifasciata subspecies matrilines and can be used to establish their natural distribution and identify hybrid colonies.
Resumo:
The objectives of the present study were to identify the cis-elements of the promoter absolutely required for the efficient rat NHE3 gene transcription and to locate positive and negative regulatory elements in the 5’-flanking sequence (5’FS), which might modulate the gene expression in proximal tubules, and to compare this result to those reported for intestinal cell lines. We analyzed the promoter activity of different 5’FS segments of the rat NHE3 gene, in the OKP renal proximal tubule cell line by measuring the activity of the reporter gene luciferase. Because the segment spanning the first 157 bp of 5’FS was the most active it was studied in more detail by sequential deletions, point mutations, and gel shift assays. The essential elements for gene transcription are in the region -85 to -33, where we can identify consensual binding sites for Sp1 and EGR-1, which are relevant to NHE3 gene basal transcription. Although a low level of transcription is still possible when the first 25 bp of the 5’FS are used as promoter, efficient transcription only occurs with 44 bp of 5’FS. There are negative regulatory elements in the segments spanning -1196 to -889 and -467 to -152, and positive enhancers between -889 and -479 bp of 5’FS. Transcription factors in the OKP cell nuclear extract efficiently bound to DNA elements of rat NHE3 promoter as demonstrated by gel shift assays, suggesting a high level of similarity between transcription factors of both species, including Sp1 and EGR-1.
Resumo:
The aim of this study was to optimize a PCR assay that amplifies an 843 pb fragment from the p28 gene of Ehrlichia canis and compare it with two other PCR methods used to amplify portions of the 16S rRNA and dsb genes of Ehrlichia. Blood samples were collected from dogs suspected of having a positive diagnosis for canine ehrlichiosis. Amplification of the p28 gene by PCR produced an 843-bp fragment and this assay could detect DNA from one gene copy among 1 billion cells. All positive samples detected by the p28-based PCR were also positive by the 16S rRNA nested-PCR and also by the dsb-based PCR. Among the p28-based PCR negative samples, 55.3% were co-negatives, but 27.6% were positive in 16S rRNA and dsb based PCR assays. The p28-based PCR seems to be a useful test for the molecular detection of E. canis, however improvements in this PCR sensitivity are desired, so that it can become an important alternative in the diagnosis of canine ehrlichiosis.
Resumo:
Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.