999 resultados para DYE-BINDING


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coloured effluents from textile industries are a problem in many rivers and waterways. Prediction of adsorption capacities of dyes by adsorbents is important in design considerations. The sorption of three basic dyes, namely Basic Blue 3, Basic Yellow 21 and Basic Red 22, onto peat is reported. Equilibrium sorption isotherms have been measured for the three single component systems. Equilibrium was achieved after twenty-one days. The experimental isotherm data were analysed using Langmuir, Freundlich, Redlich-Peterson, Temkin and Toth isotherm equations. A detailed error analysis has been undertaken to investigate the effect of using different error criteria for the determination of the single component isotherm parameters and hence obtain the best isotherm and isotherm parameters which describe the adsorption process. The linear transform model provided the highest R2 regression coefficient with the Redlich-Peterson model. The Redlich-Peterson model also yielded the best fit to experimental data for all three dyes using the non-linear error functions. An extended Langmuir model has been used to predict the isotherm data for the binary systems using the single component data. The correlation between theoretical and experimental data had only limited success due to competitive and interactive effects between the dyes and the dye-surface interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although it is well established that benzimidazole (BZMs) compounds exert their therapeutic effects through binding to helminth beta-tubulin and thus disrupting microtubule-based processes in the parasites, the precise location of the benzimidazole-binding site on the beta-tubulin molecule has yet to be determined. In the present study, we have used previous experimental data as cues to help identify this site. Firstly, benzimidazole resistance has been correlated with a phenylalanine-to-tyrosine substitution at position 200 of Haemonchus contortus beta-tubulin isotype-I. Secondly, site-directed mutagenesis studies, using fungi, have shown that other residues in this region of the protein can influence the interaction of benzimidazoles with beta-tubulin. However, the atomic structure of the alphabeta-tubulin dimer shows that residue 200 and the other implicated residues are buried within the protein. This poses the question: how might benzimidazoles interact with these apparently inaccessible residues? In the present study, we present a mechanism by which those residues generally believed to interact with benzimidazoles may become accessible to the drugs. Furthermore, by docking albendazole-sulphoxide into a modelled H. contortus beta-tubulin molecule we offer a structural explanation for how the mutation conferring benzimidazole resistance in nematodes may act, as well as a possible explanation for the species-specificity of benzimidazole anthelmintics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Small 1,000-bp fragments of genomic DNA obtained from human malignant breast cancer cell lines when transfected into a benign rat mammary cell line enhance transcription of the osteopontin gene and thereby cause the cells to metastasize in syngeneic rats. To identify the molecular events underlying this process, transient cotransfections of an osteopontin promoter-reporter construct and fragments of one metastasis-inducing DNA (Met-DNA) have identified the active components in the Met-DNA as the binding sites for the T-cell factor (Tcf) family of transcription factors. Incubation of cell extracts with active DNA fragments containing the sequence CAAAG caused retardation of their mobilities on polyacrylamide gels, and Western blotting identified Tcf-4, beta-catenin, and E-cadherin in the relevant DNA complexes in vitro. Transfection of an expression vector for Tcf-4 inhibited the stimulated activity of the osteopontin promoter-reporter construct caused by transiently transfected active fragments of Met-DNA or permanently transfected Met-DNA. This stimulated activity of the osteopontin promoter-reporter construct is accompanied by an increase in endogenous osteopontin mRNA but not in fos or actin mRNAs in the transfected cells. Permanent transfection of the benign rat mammary cell line with a 20-bp fragment from the Met-DNA containing the Tcf recognition sequence CAAAG caused an enhanced permanent production of endogenous osteopontin protein in vitro and induced the cells to metastasize in syngeneic rats in vivo. The corresponding fragment without the CAAAG sequence was without either effect. Therefore, the regulatory effect of the C9-Met-DNA is exerted, at least in part, by a CAAAG sequence that can sequester the endogenous inhibitory Tcf-4 and thereby promote transcription of osteopontin, the direct effector of metastasis in this system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Members of the evolutionarily conserved septin family of genes are emerging as key components of several cellular processes including membrane trafficking, cytokinesis, and cell-cycle control events. SEPT9 has been shown to have a complex genomic architecture, such that up to 15 different isoforms are possible by the shuffling of five alternate amino termini and three alternate carboxy termini. Genomic and transcriptional alterations of SEPT9 have been associated with neoplasia. The present study has used a Sept9-specific antibody to determine the pattern of isoform expression in a range of tumour cell lines. Western blot analysis indicated considerable variation in the relative amounts and isoform content of Sept9. Immunofluorescence studies showed a range of patterns of cytoplasmic localization ranging from mainly particulate to mainly filamentous. Expression constructs were also generated for each amino terminal isoform to investigate the patterns of localization of individual isoforms and the effects on cells of ectopic expression. The present study shows that the epsilon isoform appears filamentous in this overexpression system while the remaining isoforms are particulate and cytoplasmic. Transient transfection of individual constructs into tumour cell lines results in cell-cycle perturbation with a G2/M arrest and dramatic growth suppression, which was greatest in cell lines with the lowest amounts of endogenous Sept9. Similar phenotypic observations were made with GTP-binding mutants of all five N-terminal variants of Sept9. However, dramatic differences were observed in the kinetics of accumulation of wild-type versus mutant septin protein in transfected cells. In conclusion, the present study shows that the expression patterns of Sept9 protein are very varied in a panel of tumour cell lines and the functional studies are consistent with a model of septin function as a component of a molecular scaffold that contributes to diverse cellular functions. Alterations in the levels of Sept9 protein by overexpression of individual isoforms can clearly perturb cellular behaviour and may thus provide a mechanistic explanation for observations of deranged septin expression in neoplasia. Copyright © 2004 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reduced arterial compliance precedes changes in blood pressure, which may be mediated through alterations in vessel wall matrix composition. We investigated the effect of the collagen type I-1 gene (COL1A1) +2046G>T polymorphism on arterial compliance in healthy individuals. We recruited 489 subjects (251 men and 238 women; mean age, 22.6±1.6 years). COL1A1 genotypes were determined using polymerase chain reaction and digestion by restriction enzyme Bal1. Arterial pulse wave velocities were measured in 3 segments, aortoiliac (PWVA), aortoradial (PWVB), and aorto-dorsalis-pedis (PWVF), as an index of compliance using a noninvasive optical method. Data were available for 455 subjects. The sample was in Hardy-Weinberg equilibrium with genotype distributions and allele frequencies that were not significantly different from those reported previously. The T allele frequency was 0.22 (95% confidence interval, 0.19 to 0.24). Two hundred eighty-three (62.2%) subjects were genotype GG, 148 (35.5%) subjects were genotype GT, and 24 (5.3%) subjects were genotype TT. A comparison of GG homozygotes with GT and TT individuals demonstrated a statistically significant association with arterial compliance: PWVF 4.92±0.03 versus 5.06±0.05 m/s (ANOVA, P=0.009), PWVB 4.20±0.03 versus 4.32±0.04 m/s (ANOVA, P=0.036), and PWVA 3.07±0.03 versus 3.15±0.03 m/s (ANOVA, P=0.045). The effects of genotype were independent of age, gender, smoking, mean arterial pressure, body mass index, family history of hypertension, and activity scores. We report an association between the COL1A1 gene polymorphism and arterial compliance. Alterations in arterial collagen type 1A deposition may play a role in the regulation of arterial compliance

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dysfunction of the actin cytoskeleton is a key event in the pathogenesis of diabetic nephropathy. We previously reported that certain cytoskeletal genes are upregulated in mesangial cells exposed to a high extracellular glucose concentration. One such gene, caldesmon, lies on chromosome 7q35, a region linked to nephropathy in family studies, making it a candidate susceptibility gene for diabetic nephropathy. We screened all exons, untranslated regions, and a 5-kb region upstream of the gene for variation using denaturing high-performance liquid chromatography technology. An A>G single nucleotide polymorphism (SNP) at position -579 in the promoter region was associated with nephropathy in a case-control study using 393 type 1 diabetic patients from Northern Ireland (odds ratio [OR] 1.38, 95% CI 1.02–1.86, P = 0.03). A similar trend was found in an independent sample from a second center. When the sample groups were combined (n = 606), the association between the -579G allele and nephropathy remained significant (OR 1.35, 1.07–1.70, P = 0.01). The haplotype structure in the surrounding 7-kb region was determined. No single haplotype was more strongly associated with nephropathy than the -579A>G SNP. These results suggest a role for the caldesmon gene in susceptibility to diabetic nephropathy in type 1 diabetes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Whole-cell and inside-out patch-clamp techniques were used to assess the action of a well-known dye, Evans blue, on membrane currents in bladder isolated smooth muscle cells from sheep. In whole cells Evans blue dose-dependently increased the outward current by up to fivefold. In contrast, Evans blue had no effect on inward Ca2+ current. The effect on outward current was abolished or reduced if the cells were bathed in Ca2+-free solution, iberiotoxin (5 x 10(-8) M), or charybdotoxin (5 x 10(-8) M), but was unaffected by externally applied caffeine (5 mM) or in cells exposed to heparin (1 mg/ml) via the patch pipette. In inside-out patches bathed in a Ca2+ concentration of 5 x 10(-7) M, Evans blue (10(-4) M) increased the open probability of large-conductance (298-pS) Ca2+-dependent K+ channels (BK channels), shifting the half maximal-activation voltage by -70 mV. We conclude that Evans blue dye acts as an opener of BK channels.