947 resultados para Adverse Drug Events


Relevância:

20.00% 20.00%

Publicador:

Resumo:

High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Split-plot design (SPD) and near-infrared chemical imaging were used to study the homogeneity of the drug paracetamol loaded in films and prepared from mixtures of the biocompatible polymers hydroxypropyl methylcellulose, polyvinylpyrrolidone, and polyethyleneglycol. The study was split into two parts: a partial least-squares (PLS) model was developed for a pixel-to-pixel quantification of the drug loaded into films. Afterwards, a SPD was developed to study the influence of the polymeric composition of films and the two process conditions related to their preparation (percentage of the drug in the formulations and curing temperature) on the homogeneity of the drug dispersed in the polymeric matrix. Chemical images of each formulation of the SPD were obtained by pixel-to-pixel predictions of the drug using the PLS model of the first part, and macropixel analyses were performed for each image to obtain the y-responses (homogeneity parameter). The design was modeled using PLS regression, allowing only the most relevant factors to remain in the final model. The interpretation of the SPD was enhanced by utilizing the orthogonal PLS algorithm, where the y-orthogonal variations in the design were separated from the y-correlated variation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Seizures in some 30% to 40% of patients with epilepsy fail to respond to antiepileptic drugs or other treatments. While much has been made of the risks of new drug therapies, not enough attention has been given to the risks of uncontrolled and progressive epilepsy. This critical review summarizes known risks associated with refractory epilepsy, provides practical clinical recommendations, and indicates areas for future research. Eight international epilepsy experts from Europe, the United States, and South America met on May 4, 2013, to present, review, and discuss relevant concepts, data, and literature on the consequences of refractory epilepsy. While patients with refractory epilepsy represent the minority of the population with epilepsy, they require the overwhelming majority of time, effort, and focus from treating physicians. They also represent the greatest economic and psychosocial burdens. Diagnostic procedures and medical/surgical treatments are not without risks. Overlooked, however, is that these risks are usually smaller than the risks of long-term, uncontrolled seizures. Refractory epilepsy may be progressive, carrying risks of structural damage to the brain and nervous system, comorbidities (osteoporosis, fractures), and increased mortality (from suicide, accidents, sudden unexpected death in epilepsy, pneumonia, vascular disease), as well as psychological (depression, anxiety), educational, social (stigma, driving), and vocational consequences. Adding to this burden is neuropsychiatric impairment caused by underlying epileptogenic processes (essential comorbidities), which appears to be independent of the effects of ongoing seizures themselves. Tolerating persistent seizures or chronic medicinal adverse effects has risks and consequences that often outweigh risks of seemingly more aggressive treatments. Future research should focus not only on controlling seizures but also on preventing these consequences.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Facial cosmetic procedures are increasingly requested, and dermal filler materials have been widely used as a nonsurgical option since the 1980s. However, injectable fillers have been implicated in local adverse reactions. Therefore, the aim of this article was to describe the use of fine needle aspiration cytology (FNAC) in the diagnosis of foreign-body reactions to the perioral injection of dermal fillers. A 69-year-old woman presented with a painful nodule on her right nasolabial fold. Intraoral FNAC was performed, and cytologic smears were examined under optical and polarized light microscopy, showing birefringent microspheres, confirming the diagnosis of an adverse reaction caused by polymethyl methacrylate filler. FNAC is a less invasive method to confirm the diagnosis of adverse reactions caused by perioral cosmetic dermal fillers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hereditary angioedema (HAE) with C1 inhibitor deficiency manifests as recurrent episodes of edema involving the skin, upper respiratory tract and gastrointestinal tract. It can be lethal due to asphyxia. The aim here was to evaluate the response to therapy for these attacks using icatibant, an inhibitor of the bradykinin receptor, which was recently introduced into Brazil. Prospective experimental single-cohort study on the efficacy and safety of icatibant for HAE patients. Patients with a confirmed HAE diagnosis were enrolled according to symptoms and regardless of the time since onset of the attack. Icatibant was administered in accordance with the protocol that has been approved in Brazil. Symptom severity was assessed continuously and adverse events were monitored. 24 attacks in 20 HAE patients were treated (female/male 19:1; 19-55 years; median 29 years of age). The symptoms were: subcutaneous edema (22/24); abdominal pain (15/24) and upper airway obstruction (10/24). The time taken until onset of relief was: 5-10 minutes (5/24; 20.8%); 10-20 (5/24; 20.8%); 20-30 (8/24; 33.4%); 30-60 (5/24; 20.8%); and 2 hours (1/24; 4.3%). The time taken for complete resolution of symptoms ranged from 4.3 to 33.4 hours. Adverse effects were only reported at injection sites. Mild to moderate erythema and/or feelings of burning were reported by 15/24 patients, itching by 3 and no adverse effects in 6. HAE type I patients who received icatibant responded promptly; most achieved improved symptom severity within 30 minutes. Local adverse events occurred in 75% of the patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Substantial complexity has been introduced into treatment regimens for patients with human immunodeficiency virus (HIV) infection. Many drug-related problems (DRPs) are detected in these patients, such as low adherence, therapeutic inefficacy, and safety issues. We evaluated the impact of pharmacist interventions on CD4+ T-lymphocyte count, HIV viral load, and DRPs in patients with HIV infection. In this 18-month prospective controlled study, 90 outpatients were selected by convenience sampling from the Hospital Dia-University of Campinas Teaching Hospital (Brazil). Forty-five patients comprised the pharmacist intervention group and 45 the control group; all patients had HIV infection with or without acquired immunodeficiency syndrome. Pharmaceutical appointments were conducted based on the Pharmacotherapy Workup method, although DRPs and pharmacist intervention classifications were modified for applicability to institutional service limitations and research requirements. Pharmacist interventions were performed immediately after detection of DRPs. The main outcome measures were DRPs, CD4+ T-lymphocyte count, and HIV viral load. After pharmacist intervention, DRPs decreased from 5.2 (95% confidence interval [CI] =4.1-6.2) to 4.2 (95% CI =3.3-5.1) per patient (P=0.043). A total of 122 pharmacist interventions were proposed, with an average of 2.7 interventions per patient. All the pharmacist interventions were accepted by physicians, and among patients, the interventions were well accepted during the appointments, but compliance with the interventions was not measured. A statistically significant increase in CD4+ T-lymphocyte count in the intervention group was found (260.7 cells/mm(3) [95% CI =175.8-345.6] to 312.0 cells/mm(3) [95% CI =23.5-40.6], P=0.015), which was not observed in the control group. There was no statistical difference between the groups regarding HIV viral load. This study suggests that pharmacist interventions in patients with HIV infection can cause an increase in CD4+ T-lymphocyte counts and a decrease in DRPs, demonstrating the importance of an optimal pharmaceutical care plan.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cyclosporine, a drug used in immunosuppression protocols for hematopoietic stem cell transplantation that has a narrow therapeutic index, may cause various adverse reactions, including nephrotoxicity. This has a direct clinical impact on the patient. This study aims to summarize available evidence in the scientific literature on the use of cyclosporine in respect to its risk factor for the development of nephrotoxicity in patients submitted to hematopoietic stem cell transplantation. A systematic review was made with the following electronic databases: PubMed, Web of Science, Embase, Scopus, CINAHL, LILACS, SciELO and Cochrane BVS. The keywords used were: bone marrow transplantation OR stem cell transplantation OR grafting, bone marrow AND cyclosporine OR cyclosporin OR risk factors AND acute kidney injury OR acute kidney injuries OR acute renal failure OR acute renal failures OR nephrotoxicity. The level of scientific evidence of the studies was classified according to the Oxford Centre for Evidence Based Medicine. The final sample was composed of 19 studies, most of which (89.5%) had an observational design, evidence level 2B and pointed to an incidence of nephrotoxicity above 30%. The available evidence, considered as good quality and appropriate for the analyzed event, indicates that cyclosporine represents a risk factor for the occurrence of nephrotoxicity, particularly when combined with amphotericin B or aminoglycosides, agents commonly used in hematopoietic stem cell transplantation recipients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Up to 20% of women with hypertensive pregnancy disorders might persist with chronic hypertension. This study compared clinical and echocardiographic features between women whose hypertension began as hypertensive pregnancy disorders (PH group) and women whose diagnosis of hypertension did not occur during pregnancy (NPH group). Fifty PH and 100 NPH women were cross-sectionally evaluated by clinical, laboratory, and echocardiography analysis, and the groups were matched by duration of hypertension. PH exhibited lower age (46.6 ± 1.4 vs. 65.3 ± 1.1 years; P < .001), but higher systolic (159.8 ± 3.9 vs. 148.0 ± 2.5 mm Hg; P = .009) and diastolic (97.1 ± 2.4 vs. 80.9 ± 1.3 mm Hg; P < .001) blood pressure than NPH, although used more antihypertensive classes (3.4 ± 0.2 vs. 2.6 ± 0.1; P < .001). Furthermore, PH showed higher left ventricular wall thickness and increased prevalence of concentric hypertrophy than NPH after adjusting for age and blood pressure. In conclusion, this study showed that PH may exhibit worse blood pressure control and adverse left ventricular remodeling compared with NPH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent data suggests that cholesteryl ester transfer protein (CETP) activity may interact with acute stress conditions via inflammatory-oxidative response and thrombogenesis. We investigated this assumption in patients with ST-elevation myocardial infarction (STEMI). Consecutive patients with STEMI (n = 116) were enrolled <24-h of symptoms onset and were followed for 180 days. Plasma levels of C-reactive protein (CRP), interleukin-2 (IL-2), tumor necrosis factor (TNFα), 8-isoprostane, nitric oxide (NOx) and CETP activity were measured at enrollment (D1) and at fifth day (D5). Flow-mediated dilation (FMD) was assessed by ultrasound and coronary thrombus burden (CTB) was evaluated by angiography. Neither baseline nor the change of CETP activity from D1 to D5 was associated with CRP, IL-2, TNFα, 8-isoprostane levels or CTB. The rise in NOx from D1 to D5 was inferior [3.5(-1; 10) vs. 5.5(-1; 12); p < 0.001] and FMD was lower [5.9(5.5) vs. 9.6(6.6); p = 0.047] in patients with baseline CETP activity above the median value than in their counterparts. Oxidized HDL was measured by thiobarbituric acid reactive substances (TBARS) in isolated HDL particles and increased from D1 to D5, and remaining elevated at D30. The change in TBARS content in HDL was associated with CETP activity (r = 0.72; p = 0.014) and FMD (r = -0.61; p = 0.046). High CETP activity at admission was associated with the incidence of sudden death and recurrent MI at 30 days (OR 12.8; 95% CI 1.25-132; p = 0.032) and 180 days (OR 3.3; 95% CI 1.03-10.7; p = 0.044). An enhanced CETP activity during acute phase of STEMI is independently associated with endothelial dysfunction and adverse clinical outcome.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Clozapine displays stronger systemic metabolic side effects than haloperidol and it has been hypothesized that therapeutic antipsychotic and adverse metabolic effects of these drugs are related. Considering that cerebral disconnectivity through oligodendrocyte dysfunction has been implicated in schizophrenia, it is important to determine the effect of these drugs on oligodendrocyte energy metabolism and myelin lipid production. Effects of clozapine and haloperidol on glucose and myelin lipid metabolism were evaluated and compared in cultured OLN-93 oligodendrocytes. First, glycolytic activity was assessed by measurement of extra- and intracellular glucose and lactate levels. Next, the expression of glucose (GLUT) and monocarboxylate (MCT) transporters was determined after 6 and 24 h. And finally mitochondrial respiration, acetyl-CoA carboxylase, free fatty acids, and expression of the myelin lipid galactocerebroside were analyzed. Both drugs altered oligodendrocyte glucose metabolism, but in opposite directions. Clozapine improved the glucose uptake, production and release of lactate, without altering GLUT and MCT. In contrast, haloperidol led to higher extracellular levels of glucose and lower levels of lactate, suggesting reduced glycolysis. Antipsychotics did not alter significantly the number of functionally intact mitochondria, but clozapine enhanced the efficacy of oxidative phosphorylation and expression of galactocerebroside. Our findings support the superior impact of clozapine on white matter integrity in schizophrenia as previously observed, suggesting that this drug improves the energy supply and myelin lipid synthesis in oligodendrocytes. Characterizing the underlying signal transduction pathways may pave the way for novel oligodendrocyte-directed schizophrenia therapies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aims to evaluate the frequency and severity of nausea and vomiting using two different instruments and relate them to quality of life (QOL) in patients with cancer receiving antineoplastic treatment. Severity of chemotherapy-induced nausea and vomiting (CINV) was measured by Common Terminology Criteria for Adverse Events (CTCAE) and a numerical scale. QOL was assessed using the Functional Assessment of Cancer Therapy-General questionnaire. Of the 50 patients studied, 60.0% reported nausea (40.0% CTCAE grade 1; 66.7% moderate intensity on numerical scale) and 30.0% reported vomiting (46.7% CTCAE grades 1 and 2, each; 66.7% moderate intensity on numerical scale). CINV did not influence overall QOL. The frequency of CINV was high. There was no association between nausea/vomiting and overall QOL.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To verify the methods used by the clinical trials that assessed the effect of tactile/kinesthetic stimulation on weight gain in preterm infants and highlight the similarities and differences among such studies. This review collected studies from two databases, PEDro and PubMed, in July of 2014, in addition to bibliographies. Two researchers assessed the relevant titles independently, and then chose which studies to read in full and include in this review by consensus. Clinical trials that studied tactile stimulation or massage therapy whether or not associated with kinesthetic stimulation of preterm infants; that assessed weight gain after the intervention; that had a control group and were composed in English, Portuguese, or Spanish were included. A total of 520 titles were found and 108 were selected for manuscript reading. Repeated studies were excluded, resulting in 40 different studies. Of these, 31 met all the inclusion criteria. There were many differences in the application of tactile/kinesthetic stimulation techniques among studies, which hindered the accurate reproduction of the procedure. Also, many studies did not describe the adverse events that occurred during stimulation, the course of action taken when such events occurred, and their effect on the outcome. These studies made a relevant contribution towards indicating tactile/kinesthetic stimulation as a promising tool. Nevertheless, there was no standard for application among them. Future studies should raise the level of methodological rigor and describe the adverse events. This may permit other researchers to be more aware of expected outcomes, and a standard technique could be established.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.