Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Effect of microRNA-21 on the proliferation of human degenerated nucleus pulposus by targeting programmed cell death 4

This study aims to explore the effect of microRNA-21 (miR-21) on the proliferation of human degenerated nucleus pulposus (NP) by targeting programmed cell death 4 (PDCD4) tumor suppressor. NP tissues were collected from 20 intervertebral disc degeneration (IDD) patients, and from 5 patients with traumatic spine fracture. MiR-21 expressions were tested. NP cells from IDD patients were collected and divided into blank control group, negative control group (transfected with miR-21 negative sequences), miR-21 inhibitor group (transfected with miR-21 inhibitors), miR-21 mimics group (transfected with miR-21 mimics) and PDCD4 siRNA group (transfected with PDCD4 siRNAs). Cell growth was estimated by Cell Counting Kit-8; PDCD4, MMP-2,MMP-9 mRNA expressions were evaluated by qRT-PCR; PDCD4, c-Jun and p-c-Jun expressions were tested using western blot. In IDD patients, the expressions of miR-21 and PDCD4 mRNA were respectively elevated and decreased (both P<0.05). The miR-21 expressions were positively correlated with Pfirrmann grades, but negatively correlated with PDCD4 mRNA (both P<0.001). In miR-21 inhibitor group, cell growth, MMP-2 and MMP-9 mRNA expressions, and p-c-Jun protein expressions were significantly lower, while PDCD4 mRNA and protein expressions were higher than the other groups (all P<0.05). These expressions in the PDCD4 siRNA and miR-21 mimics groups was inverted compared to that in the miR-21 inhibitor group (all P<0.05). MiR-21 could promote the proliferation of human degenerated NP cells by targeting PDCD4, increasing phosphorylation of c-Jun protein, and activating AP-1-dependent transcription of MMPs, indicating that miR-21 may be a crucial biomarker in the pathogenesis of IDD.

Analyzing and Computing the Sustainability Gains of Building Automation

Smart home implementation in residential buildings promises to optimize energy usage and save significant amount of energy simply due to a better understanding of user's energy usage profile. Apart from the energy optimisation prospects of this technology, it also aims to guarantee occupants significant amount of comfort and remote control over home appliances both at home locations and at remote places. However, smart home investment just like any other kind of investment requires an adequate measurement and justification of the economic gains it could proffer before its realization. These economic gains could differ for different occupants due to their inherent behaviours and tendencies. Thus it is pertinent to investigate the various behaviours and tendencies of occupants in different domain of interests and to measure the value of the energy savings accrued by smart home implementations in these domains of interest in order to justify such economic gains. This thesis investigates two domains of interests (the rented apartment and owned apartment) for primarily two behavioural tendencies (Finland and Germany) obtained from observation and corroborated by conducted interviews to measure the payback time and Return on Investment (ROI) of their smart home implementations. Also, similar measures are obtained for identified Australian use case. The research finding reveals that building automation for the Finnish behavioural tendencies seems to proffers a better ROI and payback time for smart home implementations.

TAKING ADVANTAGE OF THE LOCAL ADVANTAGE? - Investment value of the analyst local advantage in the Finnish stock market in 2006–2014

An investor can either conduct independent analysis or rely on the analyses of others. Stock analysts provide markets with expectations regarding particular securities. However, analysts have different capabilities and resources, of which investors are seldom cognizant. The local advantage refers to the advantage stemming from cultural or geographical proximity to securities analyzed. The research has confirmed that local agents are generally more accurate or produce excess returns. This thesis tests the investment value of the local advantage regarding Finnish stocks via target price data. The empirical section investigates the local advantage from several aspects. It is discovered that local analysts were more focused on certain sectors generally located close to consumer markets. Market reactions to target price revisions were generally insignificant with the exception to local positive target prices. Both local and foreign target prices were overly optimistic and exhibited signs of herding. Neither group could be identified as a leader or follower of new information. Additionally, foreign price change expectations were more in line with the quantitative models and ideas such as beta or return mean reversion. The locals were more accurate than foreign analysts in 5 out of 9 sectors and vice versa in one. These sectors were somewhat in line with coverage decisions and buttressed the idea of local advantage stemming from proximity to markets, not to headquarters. The accuracy advantage was dependent on sample years and on the measure used. Local analysts ranked magnitudes of price changes more accurately in optimistic and foreign analysts in pessimistic target prices. Directional accuracy of both groups was under 50% and target prices held no linear predictive power. Investment value of target prices were tested by forming mean-variance efficient portfolios. Parallel to differing accuracies in the levels of expectations foreign portfolio performed better when short sales were allowed and local better when disallowed. Both local and non-local portfolios performed worse than a passive index fund, albeit not statistically significantly. This was in line with previously reported low overall accuracy and different accuracy profiles. Refraining from estimating individual stock returns altogether produced statistically significantly higher Sharpe ratios compared to local or foreign portfolios. The proposed method of testing the investment value of target prices of different groups suffered from some inconsistencies. Nevertheless, these results are of interest to investors seeking the advice of security analysts.

Analysis of testicular cell populations using flow cytometry

Studying testis is complex, because the tissue has a very heterogeneous cell composition and its structure changes dynamically during development. In reproductive field, the cell composition is traditionally studied by morphometric methods such as immunohistochemistry and immunofluorescence. These techniques provide accurate quantitative information about cell composition, cell-cell association and localization of the cells of interest. However, the sample preparation, processing, staining and data analysis are laborious and may take several working days. Flow cytometry protocols coupled with DNA stains have played an important role in providing quantitative information of testicular cells populations ex vivo and in vitro studies. Nevertheless, the addition of specific cells markers such as intracellular antibodies would allow the more specific identification of cells of crucial interest during spermatogenesis. For this study, adult rat Sprague-Dawley rats were used for optimization of the flow cytometry protocol. Specific steps within the protocol were optimized to obtain a singlecell suspension representative of the cell composition of the starting material. Fixation and permeabilization procedure were optimized to be compatible with DNA stains and fluorescent intracellular antibodies. Optimization was achieved by quantitative analysis of specific parameters such as recovery of meiotic cells, amount of debris and comparison of the proportions of the various cell populations with already published data. As a result, a new and fast flow cytometry method coupled with DNA stain and intracellular antigen detection was developed. This new technique is suitable for analysis of population behavior and specific cells during postnatal testis development and spermatogenesis in rodents. This rapid protocol recapitulated the known vimentin and γH2AX protein expression patterns during rodent testis ontogenesis. Moreover, the assay was applicable for phenotype characterization of SCRbKO and E2F1KO mouse models.

Weldability of high strength aluminium alloys

The need for reduced intrinsic weight of structures and vehicles in the transportation industry has made aluminium research of interest. Aluminium has properties that are favourable for structural engineering, including good strength-to-weight ratio, corrosion resistance and machinability. It can be easily recycled saving energy used in smelting as compared to steel. Its alloys can have ultimate tensile strength of up to 750 MPa, which is comparable to steel. Aluminium alloys are generally weldable, however welding of high strength alloys like the 7xxx series pose considerable challenges. This paper presents research on the weldability of high strength aluminium alloys, principally the 7xxx series. The weldability with various weld processes including MIG, TIG, and FSW, is discussed in addition to consideration of joint types, weld defects and recommendations for minimizing or preventing weld defects. Experimental research was carried out on 7025-T6 and AW-7020 alloys. Samples were welded, and weld cross sections utilized in weld metallurgy studies. Mechanical tests were carried out including hardness tests and tensile tests. In addition, testing was done for the presence of Al2O3 on exposed aluminium alloy. It was observed that at constant weld heat input using a pulsed MIG system, the welding speed had little or no effect on the weld hardness. However, the grain size increased as the filler wire feed rate, welding current and welding speed increased. High heat input resulted in lower hardness of the weld profile. Weld preheating was detrimental to AW- 7020 welds; however, artificial aging was beneficial. Acceptable welds were attained with pulsed MIG without the removal of the Al2O3 layer prior to welding. The Al2O3 oxide layer was found to have different compositions in different aluminium alloys. These findings contribute useful additional information to the knowledge base of aluminium welding. The application of the findings of this study in welding will help reduce weld cost and improve high strength aluminium structure productivity by removing the need for pre-weld cleaning. Better understanding of aluminium weld metallurgy equips weld engineers with information for better aluminium weld design.

Development of 3D super-resolution tomographic STED microscopy and its application to studies on bone resorption

In this doctoral thesis, a tomographic STED microscopy technique for 3D super-resolution imaging was developed and utilized to observebone remodeling processes. To improve upon existing methods, wehave used a tomographic approach using a commercially available stimulated emission depletion (STED) microscope. A certain region of interest (ROI) was observed at two oblique angles: one at a standard inverted configuration from below (bottom view) and another from the side (side view) via a micro-mirror positioned close to the ROI. The two viewing angles were reconstructed into a final tomogram. The technique, named as tomographic STED microscopy, was able to achieve an axial resolution of approximately 70 nm on microtubule structures in a fixed biological specimen. High resolution imaging of osteoclasts (OCs) that are actively resorbing bone was achieved by creating an optically transparent coating on a microscope coverglass that imitates a fractured bone surface. 2D super-resolution STED microscopy on the bone layer showed approximately 60 nm of lateral resolution on a resorption associated organelle allowing these structures to be imaged with super-resolution microscopy for the first time. The developed tomographic STED microscopy technique was further applied to study resorption mechanisms of OCs cultured on the bone coating. The technique revealed actin cytoskeleton with specific structures, comet-tails, some of which were facing upwards and some others were facing downwards. This, in our opinion, indicated that during bone resorption, an involvement of the actin cytoskeleton in vesicular exocytosis and endocytosis is present. The application of tomographic STED microscopy in bone biology demonstrated that 3D super-resolution techniques can provide new insights into biological 3D nano-structures that are beyond the diffraction-limit when the optical constraints of super-resolution imaging are carefully taken into account.

Modelling the simultaneous effects of intellectual capital and knowledge management on the organisational performance of Finnish companies

The aim of this study was to contribute to the current knowledge-based theory by focusing on a research gap that exists in the empirically proven determination of the simultaneous but differentiable effects of intellectual capital (IC) assets and knowledge management (KM) practices on organisational performance (OP). The analysis was built on the past research and theoreticised interactions between the latent constructs specified using the survey-based items that were measured from a sample of Finnish companies for IC and KM and the dependent construct for OP determined using information available from financial databases. Two widely used and commonly recommended measures in the literature on management science, i.e. the return on total assets (ROA) and the return on equity (ROE), were calculated for OP. Thus the investigation of the relationship between IC and KM impacting OP in relation to the hypotheses founded was possible to conduct using objectively derived performance indicators. Using financial OP measures also strengthened the dynamic features of data needed in analysing simultaneous and causal dependences between the modelled constructs specified using structural path models. The estimates were obtained for the parameters of structural path models using a partial least squares-based regression estimator. Results showed that the path dependencies between IC and OP or KM and OP were always insignificant when analysed separate to any other interactions or indirect effects caused by simultaneous modelling and regardless of the OP measure used that was either ROA or ROE. The dependency between the constructs for KM and IC appeared to be very strong and was always significant when modelled simultaneously with other possible interactions between the constructs and using either ROA or ROE to define OP. This study, however, did not find statistically unambiguous evidence for proving the hypothesised causal mediation effects suggesting, for instance, that the effects of KM practices on OP are mediated by the IC assets. Due to the fact that some indication about the fluctuations of causal effects was assessed, it was concluded that further studies are needed for verifying the fundamental and likely hidden causal effects between the constructs of interest. Therefore, it was also recommended that complementary modelling and data processing measures be conducted for elucidating whether the mediation effects occur between IC, KM and OP, the verification of which requires further investigations of measured items and can be build on the findings of this study.

Use of airborne laser scanner data in demanding forest conditions

Most of the applications of airborne laser scanner data to forestry require that the point cloud be normalized, i.e., each point represents height from the ground instead of elevation. To normalize the point cloud, a digital terrain model (DTM), which is derived from the ground returns in the point cloud, is employed. Unfortunately, extracting accurate DTMs from airborne laser scanner data is a challenging task, especially in tropical forests where the canopy is normally very thick (partially closed), leading to a situation in which only a limited number of laser pulses reach the ground. Therefore, robust algorithms for extracting accurate DTMs in low-ground-point-densitysituations are needed in order to realize the full potential of airborne laser scanner data to forestry. The objective of this thesis is to develop algorithms for processing airborne laser scanner data in order to: (1) extract DTMs in demanding forest conditions (complex terrain and low number of ground points) for applications in forestry; (2) estimate canopy base height (CBH) for forest fire behavior modeling; and (3) assess the robustness of LiDAR-based high-resolution biomass estimation models against different field plot designs. Here, the aim is to find out if field plot data gathered by professional foresters can be combined with field plot data gathered by professionally trained community foresters and used in LiDAR-based high-resolution biomass estimation modeling without affecting prediction performance. The question of interest in this case is whether or not the local forest communities can achieve the level technical proficiency required for accurate forest monitoring. The algorithms for extracting DTMs from LiDAR point clouds presented in this thesis address the challenges of extracting DTMs in low-ground-point situations and in complex terrain while the algorithm for CBH estimation addresses the challenge of variations in the distribution of points in the LiDAR point cloud caused by things like variations in tree species and season of data acquisition. These algorithms are adaptive (with respect to point cloud characteristics) and exhibit a high degree of tolerance to variations in the density and distribution of points in the LiDAR point cloud. Results of comparison with existing DTM extraction algorithms showed that DTM extraction algorithms proposed in this thesis performed better with respect to accuracy of estimating tree heights from airborne laser scanner data. On the other hand, the proposed DTM extraction algorithms, being mostly based on trend surface interpolation, can not retain small artifacts in the terrain (e.g., bumps, small hills and depressions). Therefore, the DTMs generated by these algorithms are only suitable for forestry applications where the primary objective is to estimate tree heights from normalized airborne laser scanner data. On the other hand, the algorithm for estimating CBH proposed in this thesis is based on the idea of moving voxel in which gaps (openings in the canopy) which act as fuel breaks are located and their height is estimated. Test results showed a slight improvement in CBH estimation accuracy over existing CBH estimation methods which are based on height percentiles in the airborne laser scanner data. However, being based on the idea of moving voxel, this algorithm has one main advantage over existing CBH estimation methods in the context of forest fire modeling: it has great potential in providing information about vertical fuel continuity. This information can be used to create vertical fuel continuity maps which can provide more realistic information on the risk of crown fires compared to CBH.

Perception of privacy in smartphone applications: profiling users based on personality types.

This document is focused on studying privacy perception and personality traits of users in the context of smartphone application privacy. It is divided into two parts. The first part presents an in depth systematic literature review of the existing academic writings available on the topic of relation between privacy perception and personality traits. Demographics, methodologies and other useful insight is extracted and the available literature is divided into broader group of topics bringing the five main areas of research to light and highlighting the current research trends in the field along with pinpointing the research gap of interest to the author. The second part of the thesis uses the results from the literature review to administer an empirical study to investigate the current privacy perception of users and the correlation between personality traits and privacy perception in smartphone applications. Big five personality test is used as the measure for personality traits whereas three sub-variables are used to measure privacy perception i.e. perceived privacy awareness, perceived threat to privacy and willingness to trade privacy. According to the study openness to experience is the most dominant trait having a strong correlation with two privacy sub-variables whereas emotional stability doesn’t show any correlation with privacy perception. Empirical study also explores other findings as preferred privacy sources and application installation preferences that provide further insight about users and might be useful in future.

TAKING ADVANTAGE OF THE LOCAL ADVANTAGE? - Investment value of the analyst local advantage in the Finnish stock market in 2006–2014

An investor can either conduct independent analysis or rely on the analyses of others. Stock analysts provide markets with expectations regarding particular securities. However, analysts have different capabilities and resources, of which investors are seldom cognizant. The local advantage refers to the advantage stemming from cultural or geographical proximity to securities analyzed. The research has confirmed that local agents are generally more accurate or produce excess returns. This thesis tests the investment value of the local advantage regarding Finnish stocks via target price data. The empirical section investigates the local advantage from several aspects. It is discovered that local analysts were more focused on certain sectors generally located close to consumer markets. Market reactions to target price revisions were generally insignificant with the exception to local positive target prices. Both local and foreign target prices were overly optimistic and exhibited signs of herding. Neither group could be identified as a leader or follower of new information. Additionally, foreign price change expectations were more in line with the quantitative models and ideas such as beta or return mean reversion. The locals were more accurate than foreign analysts in 5 out of 9 sectors and vice versa in one. These sectors were somewhat in line with coverage decisions and buttressed the idea of local advantage stemming from proximity to markets, not to headquarters. The accuracy advantage was dependent on sample years and on the measure used. Local analysts ranked magnitudes of price changes more accurately in optimistic and foreign analysts in pessimistic target prices. Directional accuracy of both groups was under 50% and target prices held no linear predictive power. Investment value of target prices were tested by forming mean-variance efficient portfolios. Parallel to differing accuracies in the levels of expectations foreign portfolio performed better when short sales were allowed and local better when disallowed. Both local and non-local portfolios performed worse than a passive index fund, albeit not statistically significantly. This was in line with previously reported low overall accuracy and different accuracy profiles. Refraining from estimating individual stock returns altogether produced statistically significantly higher Sharpe ratios compared to local or foreign portfolios. The proposed method of testing the investment value of target prices of different groups suffered from some inconsistencies. Nevertheless, these results are of interest to investors seeking the advice of security analysts.

NEGOTIATING IN FINNISH GROCERY RETAIL - Negotiation Narratives of S-group, Kesko and Lidl

In this research retail negotiations are explored through the question: What characteristics are distinctive to negotiating in Finnish grocery retail trade? To shed light on the research question I interviewed experienced retail negotiators and mapped out the most important characteristics of the retail negotiations. I described through examples the most prominent challenges negotiators face in their negotiations and elaborated what kind of tools the experienced negotiators use to overcome those challenges. The research results add up to a groundwork frame for retail negotiations with which further research can be more easily directed to any area of interest in the Finnish grocery retail negotiations. The framework can give ideas or frames for further research, or function as a general guideline of factors to consider when negotiating in Finnish retail field. The results were divided into 3 sections: Characteristics, Challenges and Tools. Different negotiation models help negotiators and researchers understand negotiation dynamics. This research adds to that pool by focusing on elements essential to consider specifically in the context of Finnish retail. Finland offered an exceptionally interesting setting to study negotiation, as grocery retail trade in Finland is highly centralized. Especially for those interested understanding a centralized setting such as Finland’s retail field, the framework presented in this research might provide a valuable spectrum of essential negotiation elements. Learning is a lifelong process, but that path can be evened by tuning in on what others have learned during their own endeavors in similar situations. Seasoned negotiators have many stories to tell about negotiating that can be drawn upon and by doing so, we can avoid having to spend time learning the same insights twice. This research drew on narrative, case-research and interviewing to find out how seasoned negotiators in the field of Finnish retail experienced negotiation, what challenges negotiations pose and what tools can be used to overcome them

Physiological reactivity and the perception of emotional stimuli as they relate to social adaptive functioning after traumatic brain injury / y Melonie Jane Hopkins.

Traumatic brain injury (TBI) often affects social adaptive functioning and these changes in social adaptability are usually associated with general damage to the frontal cortex. Recent evidence suggests that certain neurons within the orbitofrontal cortex appear to be specialized for the processing of faces and facial expressions. The orbitofrontal cortex also appears to be involved in self-initiated somatic activation to emotionally-charged stimuli. According to Somatic Marker Theory (Damasio, 1994), the reduced physiological activation fails to provide an individual with appropriate somatic cues to personally-relevant stimuli and this, in turn, may result in maladaptive behaviour. Given the susceptibility of the orbitofrontal cortex in TBI, it was hypothesized that impaired perception and reactivity to socially-relevant information might be responsible for some of the social difficulties encountered after TBL Fifteen persons who sustained a moderate to severe brain injury were compared to age and education matched Control participants. In the first study, both groups were presented with photographs of models displaying the major emotions and either asked to identify the emotions or simply view the faces passively. In a second study, participants were asked to select cards from decks that varied in terms of how much money could be won or lost. Those decks with higher losses were considered to be high-risk decks. Electrodermal activity was measured concurrently in both situations. Relative to Controls, TBI participants were found to have difficulty identifying expressions of surprise, sadness, anger, and fear. TBI persons were also found to be under-reactive, as measured by electrodermal activity, while passively viewing slides of negative expressions. No group difference,in reactivity to high-risk card decks was observed. The ability to identify emotions in the face and electrodermal reactivity to faces and to high-risk decks in the card game were examined in relationship to social monitoring and empathy as described by family members or friends on the Brock Adaptive Functioning Questionnaire (BAFQ). Difficulties identifying negative expressions (i.e., sadness, anger, fear, and disgust) predicted problems in monitoring social situations. As well, a modest relationship was observed between hypo-arousal to negative faces and problems with social monitoring. Finally, hypo-arousal in the anticipation of risk during the card game related to problems in empathy. In summary, these data are consistent with the view that alterations in the ability to perceive emotional expressions in the face and the disruption in arousal to personally-relevant information may be accounting for some of the difficulties in social adaptation often observed in persons who have sustained a TBI. Furthermore, these data provide modest support for Damasio's Somatic Marker Theory in that physiological reactivity to socially-relevant information has some value in predicting social function. Therefore, the assessment of TBI persons, particularly those with adaptive behavioural problems, should be expanded to determine whether alterations in perception and reactivity to socially-relevant stimuli have occurred. When this is the case, rehabilitative strategies aimed more specifically at these difficulties should be considered.

Effectiveness of computer training on attentional skills

This paper presents two studies, both examining the efficacy of a computer programme (Captain's Log) in training attentional skills. The population of interest is the traumatically brain injured. Study #1 is a single-case design that offers recommendations for the second, .larger (N=5) inquiry. Study #2 is an eight-week hierarchical treatment programme with a multi-based testing component. Attention, memory, listening comprehension, locus-of-control, self-esteem, visuo-spatial, and general outcome measures are employed within the testing schedule. Results suggest that any improvement was a result of practice effects. With a few single-case exceptions, the participants showed little improvement in the dependent measures.