Jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) food habits in a mosaic of Atlantic Rainforest and eucalypt plantations of southeastern Brazil

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Apedunculata discoidea gen. n., sp. n. (Monogenea: Dactylogyridae) parasitic on Prochilodus lineatus (Valenciennes, 1837) (Characiformes: Prochilodontidae) from southeastern Brazil

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Práticas escolares e desempenho acadêmico de alunos com TDAH

This article reports the results from the research work which objects the critical and profound study about the ADHD (Attention Deficit/Hyperactivity Disorder) in the courses for teachers' development in College Education, under its various dimensions - social, cultural, pedagogical, biological. The investigation focused on five adults with diagnosis for ADHD. The methodology used was the Case Study, developed from the Oral History as a source of data. The results that were obtained suggest that the study, proposed in the research, may contribute significantly for the teachers to know determining factors of the school performance of students with this disorder, as well as to guide them in the search of partnership with other professionals - doctors and psychologists, for example - when such partnership becomes necessary.

A moradia estudantil universitária como tema na produção científica nacional

This study analyses the national scientific production about college students' residence halls. The country's main data bases and electronic sites of several Brazilian higher education institutions were checked and 23 studies, published between 2000 and 2009, were found. The results of our analysis point to different focuses, which can be grouped into three categories: students who live in residence halls, residence halls themselves and actions for student assistance. Although there is large foreign scientific production about college student housing, the national production on this theme is still scarce, and the idea of student residence halls as educational spaces is still very incipient. The study points out to the need for investigating the living conditions in these places, and the impacts of this kind of habitation on students. Considering that student housing is an institutional responsibility, these studies potentially subsidize measures for proper educational conditions for college students.

Viral hepatitis in patients infected with human immunodeficiency virus

From 1992 to 1995 we studied 232 (69% male, 87% Caucasian) anti-human immunodeficiency virus (anti-HIV) positive Brazilian patients, through a questionnaire; HIV had been acquired sexually by 50%, from blood by 32%, sexually and/or from blood by 16.4% and by an unknown route by 1.7%. Intravenous drug use was reported by 29%; it was the most important risk factor for HIV transmission. The alanine aminotransferase quotient (qALT) was >1 for 40% of the patients, 93.6% had anti-hepatitis A virus antibody, 5.3% presented hepatitis B surface antigen, 44% were anti-hepatitis B core antigen positive and 53.8% were anti-hepatitis C virus (anti-HCV) positive. The anti-HCV test showed a significant association with qALT>1. Patients for whom the probable HIV transmission route was blood had a 10.8 times greater risk of being anti-HCV positive than patients infected by other routes. Among 30 patients submitted to liver biopsy, 18 presented chronic hepatitis.

Fatores associados à maior mortalidade e tempo de internação prolongado em uma unidade de terapia intensiva de adultos

OBJECTIVE: The intensive care unit is synonymous of high severity, and its mortality rates are between 5.4 and 33%. With the development of new technologies, a patient can be maintained for long time in the unit, causing high costs, psychological and moral for all involved. This study aimed to evaluate the risk factors for mortality and prolonged length of stay in an adult intensive care unit. METHODS: The study included all patients consecutively admitted to the adult medical/surgical intensive care unit of Hospital das Clínicas da Universidade Estadual de Campinas, for six months. We collected data such as sex, age, diagnosis, personal history, APACHE II score, days of invasive mechanical ventilation orotracheal reintubation, tracheostomy, days of hospitalization in the intensive care unit and discharge or death in the intensive care unit. RESULTS: Were included in the study 401 patients; 59.6% men and 40.4% women, age 53.8±18.0. The mean intensive care unit stay was 8.2±10.8 days, with a mortality rate of 13.5%. Significant data for mortality and prolonged length of stay in intensive care unit (p <0.0001), were: APACHE II>11, OT-Re and tracheostomy. CONCLUSION: The mortality and prolonged length of stay in intensive care unit intensive care unit as risk factors were: APACHE>11, orotracheal reintubation and tracheostomy.

Metamorfose planar via métodos Level Set e Particle Level Set para a reconstrução de superfícies tridimensionais

Evolving interfaces were initially focused on solutions to scientific problems in Fluid Dynamics. With the advent of the more robust modeling provided by Level Set method, their original boundaries of applicability were extended. Specifically to the Geometric Modeling area, works published until then, relating Level Set to tridimensional surface reconstruction, centered themselves on reconstruction from a data cloud dispersed in space; the approach based on parallel planar slices transversal to the object to be reconstructed is still incipient. Based on this fact, the present work proposes to analyse the feasibility of Level Set to tridimensional reconstruction, offering a methodology that simultaneously integrates the proved efficient ideas already published about such approximation and the proposals to process the inherent limitations of the method not satisfactorily treated yet, in particular the excessive smoothing of fine characteristics of contours evolving under Level Set. In relation to this, the application of the variant Particle Level Set is suggested as a solution, for its intrinsic proved capability to preserve mass of dynamic fronts. At the end, synthetic and real data sets are used to evaluate the presented tridimensional surface reconstruction methodology qualitatively.

Rootstocks induce contrasting photosynthetic responses of orange plants to low night temperature without affecting the antioxidant metabolism

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.

Physiological limitations in two sugarcane varieties under water suppression and after recovering

Increasing water scarcity and depleted water productivity in irrigated soils are inducing farmers to adopt improved varieties, such as those with high-capacity tolerance. The use of tolerant varieties of sugarcane might substantially avoid the decline of productivity under water deficit. This research aimed to evaluate the harmful effects of drought on the physiology of two sugarcane varieties (RB867515 and RB962962) during the initial development. Young plants were subjected to irrigation suspension until total stomata closure, and then rewatered. Significant reduction on stomatal conductance, transpiration, and net photosynthesis were observed. RB867515 showed a faster stomatal closure while RB962962 slowed the effects of drought on the gas exchanges parameters with a faster recovering after rewatering. Accumulation of carbohydrates, amino acids, proline, and protein in the leaves and roots of the stressed plants occurred in both varieties, substantially linked to reduction of the leaf water potential. Due to the severity of stress, this accumulation was not enough to maintain the cell turgor pressure, so relative water content was diminished. Water stress affected the contents of chlorophyll (a, b, and total) in both varieties, but not the levels of carotenoids. There was a significant reduction in dry matter under stress. In conclusion, RB962962 variety endured stressed conditions more than RB867515, since it slowed down the damaging effects of drought on the gas exchanges. In addition, RB962962 presented a faster recovery than RB867515, a feature that qualifies it as a variety capable of enduring short periods of drought without major losses in the initial stage of its development.

Unusual branching in the palm Euterpe edulis Mart

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Uma nova espécie de Mimosa L. (Leguminosae, Mimosoideae) do Centro-Oeste do Brasil

A new species of Mimosa (Leguminosae, Mimosoideae, Mimosae) from Mato Grosso do Sul state, Midwestern Brazil, M. ferricola R.R. Silva & A.M.G. Azevedo, is described and illustrated. Morphologically M. ferricola is related to M. gemmulata Barneby and to M. nothopteris Barneby, and belongs to Mimosa sect. Batocaulon DC. ser. Leiocarpae Benth.

Antioxidative responses of cell suspension cultures of two Coffea arabica varieties to low aluminum levels at pH 5.8

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Atypical antipsychotics in the treatment of pathological aggression in children and adolescents: literature review and clinical recommendations

Objective: To review the literature about the use of atypical antipsychotics in the treatment of pathological aggression in children and adolescents. Method: The databases MEDLINE, SciELO, and LILACS were searched for publications in Portuguese or English from 1992 to August 2011 using the following keywords: mental disease, child, adolescent, treatment, atypical antipsychotic, aggressive behavior, aggression, and violent behavior. Results: Sixty-seven studies of good methodological quality and clinical interest and relevance were identified. Studies including children and adolescents were relatively limited, because few atypical antipsychotics have been approved by the Food and Drug Administration (FDA). All the medications included in this review (risperidone, olanzapine, quetiapine, ziprasidone, aripiprazole and clozapine) have some effectiveness in treating aggression in children and adolescents, and choices should be based on clinical indications and side effects. Conclusions: There are few studies about the effectiveness and safety of atypical antipsychotics for the pediatric population, and further randomized controlled studies with larger groups of patients and more diagnostic categories, such as severe conduct disorder and oppositional defiant disorder, should be conducted to confirm the results reported up to date and to evaluate the impact of long-term use.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.