Metodologia para re-sintonia de controladores PID industriais

The present work has as objective to present a method of project and implementation of controllers PID, based on industrial instrumentation. An automatic system of auto-tunning of controllers PID will be presented, for systems of first and second order. The software presented in this work is applied in controlled plants by PID controllers implemented in a CLP. Software is applied to make the auto-tunning of the parameters of controller PID of plants that need this tunning. Software presents two stages, the first one is the stage of identification of the system using the least square recursive algorithm and the second is the stage of project of the parameters of controller PID using the root locus algorithm. An important fact of this work is the use of industrial instrumentation for the accomplishment of the experiments. The experiments had been carried through in controlled real plants for controllers PID implemented in the CLP. Thus has not only one resulted obtained with theoreticians experiments made with computational programs, and yes resulted obtained of real systems. The experiments had shown good results gotten with developed software

Uma proposta de metodologia para o ensino de Física usando robótica de baixíssimo custo

This paper presents methodology based on Lev Vigotsky`s social interactionist theory through investigative activities, which integrates the teaching of physics to robotics, directed to students of the Physics degree course, seeking to provide further training for future teachers. The method is organized through educational robotics workshops that addresses concepts of physics through the use of low-cost educational robots along with several activities. The methodology has been presented and discussed and put into practice afterwards in workshops so that these future teachers may be able to take robotics to their classroom. Students from the last and penultimate semester of the Physics degree course of the Federal Institute of Education, Science and Technology of Rio Grande do Norte, Caicó campus participated in this project

Otimização de forma aplicando B-splines sob critério integral de tensões

This work proposes a computational methodology to solve problems of optimization in structural design. The application develops, implements and integrates methods for structural analysis, geometric modeling, design sensitivity analysis and optimization. So, the optimum design problem is particularized for plane stress case, with the objective to minimize the structural mass subject to a stress criterion. Notice that, these constraints must be evaluated at a series of discrete points, whose distribution should be dense enough in order to minimize the chance of any significant constraint violation between specified points. Therefore, the local stress constraints are transformed into a global stress measure reducing the computational cost in deriving the optimal shape design. The problem is approximated by Finite Element Method using Lagrangian triangular elements with six nodes, and use a automatic mesh generation with a mesh quality criterion of geometric element. The geometric modeling, i.e., the contour is defined by parametric curves of type B-splines, these curves hold suitable characteristics to implement the Shape Optimization Method, that uses the key points like design variables to determine the solution of minimum problem. A reliable tool for design sensitivity analysis is a prerequisite for performing interactive structural design, synthesis and optimization. General expressions for design sensitivity analysis are derived with respect to key points of B-splines. The method of design sensitivity analysis used is the adjoin approach and the analytical method. The formulation of the optimization problem applies the Augmented Lagrangian Method, which convert an optimization problem constrained problem in an unconstrained. The solution of the Augmented Lagrangian function is achieved by determining the analysis of sensitivity. Therefore, the optimization problem reduces to the solution of a sequence of problems with lateral limits constraints, which is solved by the Memoryless Quasi-Newton Method It is demonstrated by several examples that this new approach of analytical design sensitivity analysis of integrated shape design optimization with a global stress criterion purpose is computationally efficient

Simulação computacional da interação fluido-estrutura em bombas de cavidades progressivas

The pumping through progressing cavities system has been more and more employed in the petroleum industry. This occurs because of its capacity of elevation of highly viscous oils or fluids with great concentration of sand or other solid particles. A Progressing Cavity Pump (PCP) consists, basically, of a rotor - a metallic device similar to an eccentric screw, and a stator - a steel tube internally covered by a double helix, which may be rigid or deformable/elastomeric. In general, it is submitted to a combination of well pressure with the pressure generated by the pumping process itself. In elastomeric PCPs, this combined effort compresses the stator and generates, or enlarges, the clearance existing between the rotor and the stator, thus reducing the closing effect between their cavities. Such opening of the sealing region produces what is known as fluid slip or slippage, reducing the efficiency of the PCP pumping system. Therefore, this research aims to develop a transient three-dimensional computational model that, based on single-lobe PCP kinematics, is able to simulate the fluid-structure interaction that occurs in the interior of metallic and elastomeric PCPs. The main goal is to evaluate the dynamic characteristics of PCP s efficiency based on detailed and instantaneous information of velocity, pressure and deformation fields in their interior. To reach these goals (development and use of the model), it was also necessary the development of a methodology for generation of dynamic, mobile and deformable, computational meshes representing fluid and structural regions of a PCP. This additional intermediary step has been characterized as the biggest challenge for the elaboration and running of the computational model due to the complex kinematic and critical geometry of this type of pump (different helix angles between rotor and stator as well as large length scale aspect ratios). The processes of dynamic generation of meshes and of simultaneous evaluation of the deformations suffered by the elastomer are fulfilled through subroutines written in Fortan 90 language that dynamically interact with the CFX/ANSYS fluid dynamic software. Since a structural elastic linear model is employed to evaluate elastomer deformations, it is not necessary to use any CAE package for structural analysis. However, an initial proposal for dynamic simulation using hyperelastic models through ANSYS software is also presented in this research. Validation of the results produced with the present methodology (mesh generation, flow simulation in metallic PCPs and simulation of fluid-structure interaction in elastomeric PCPs) is obtained through comparison with experimental results reported by the literature. It is expected that the development and application of such a computational model may provide better details of the dynamics of the flow within metallic and elastomeric PCPs, so that better control systems may be implemented in the artificial elevation area by PCP

Painéis-sanduíche com núcleo de EPS reciclado: metodologia de execução e determinação de propriedades termofísicas

New materials made from industrial wastes have been studied as an alternative to traditional fabrication processes in building and civil engineering. These materials are produced considering some issues like: cost, efficiency and reduction of nvironmental damage. Specifically in cases of materials destined to dwellings in low latitude regions, like Brazilian Northeast, efficiency is related to mechanical and thermal resistance. Thus, when thermal insulation and energetic efficiency are aimed, it s important to increase thermal resistance without depletion of mechanical properties. This research was conducted on a construction element made of two plates of cement mortar, interspersed with a plate of recycled expanded polystyrene (EPS). This component, widely known as sandwich-panel, is commonly manufactured with commercial EPS whose substitution was proposed in this study. For this purpose it was applied a detailed methodology that defines parameters to a rational batching of the elements that constitute the nucleus. Samples of recycled EPS were made in two different values of apparent specific mass (ρ = 65 kg/m³; ρ = 130 kg/m³) and submitted to the Quick-Line 30TM that is a thermophysical properties analyzer. Based on the results of thermal conductivity, thermal capacity and thermal diffusivity obtained, it was possible to assure that recycled EPS has thermal insulation characteristics that qualify it to replace commercial EPS in building and civil engineering industry

Metodologia de análise e diagnóstico de fratura em um componente automotivo sujeito a cargas cíclicas alternadas

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Metodologia, Sistema de Codificação e Ferramenta de software para Modelagem de Móveis Modulados

On this research we investigated how new technologies can help the process of design and manufacturing of furniture in such small manufacturers in Rio Grande do Norte state. Google SketchUp, a 3D software tool, was developed in such a way that its internal structures are opened and can be accessed using SketchUp s API for Ruby and programs written in Ruby language (plugins). Using the concepts of the so-called Group Technology and the flexibility that enables adding new functionalities to this software, it was created a Methodology for Modeling of Furniture, a Coding System and a plugin for Google s tool in order to implement the Methodology developed. As resulted, the following facilities are available: the user may create and reuse the library s models over-and-over; reports of the materials manufacturing process costs are provided and, finally, detailed drawings, getting a better integration between the furniture design and manufacturing process

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comparação da precisão dos resultados do teste de tetrazolio usando a metodologia alternativa e a tradicional em sementes de soja

The use of tetrazolium testing is recognized in the soybean seed quality control due to the large amount of data which it provides. Although it is considered a quick test, in 1998 an alternative methodology was proposed for the seed preconditioning, which allows 10 hours of time saving in seeds preparation. The objective of this research is to compare the accuracy of the new and the traditional tetrazolium testing. Three soybean seed genotypes were used, Conquista, Garantia and M-soy 8400, all 2000/2001 crop. The seeds were evaluated in relation to germination, evaluated with the traditional (TZt) and the alternative (Tza) tetrazolium test as well as with the accelerated aging performed in two different conditions (45 degrees C 24h(-1) and 45 degrees C 72h(-1)). After aging, the seeds too were submitted to TZt and Tza testing. The experimental design was a randomized blocks, with four replicates the 50 seeds per genotype in every evaluation, with exception only for tetrazolium test, with two replicates. The averages were compared in the Tukey test level of 5% probability. The comparison between the two methodologies in relation to level of vigor (class 1 to 3) and germination potential (class 1 to 5) indicated no statistical discrepancies, for aged non-aged seeds. This, the use of the alternative tetrazolium test is recommend in case a reduced seed preparation time is needed.

Tratamento de materiais contaminados com bifenilas policloradas (PCBS) via extração convencional e fluído supercrítico

The decontamination of the materials has been subject of some studies. One of the factors that it increases the pollution is the lack of responsibility in the discarding of toxic trash, as for example the presence of PCB (Polychlorinated Biphenyls) in the environment. In the Brazilian regulations, the material contaminated with PCB in concentrations higher than 50 ppm must be stored in special places or destroyed, usually by incineration in plasma furnace with dual steps. Due to high cost of the procedure, new methodologies of PCBs removal has been studied. The objective of this study was to develop an experimental methodology and analytical methodology for quantification of removal of PCBs through out the processes of extractions using supercritical fluid and Soxhlet method, also technical efficiency of the two processes of extraction, in the treatment of contaminated materials with PCBs. The materials studied were soils and wood, both were simulated contamination with concentration of 6.000, 33.000 and 60.000 mg of PCB/ kg of materials. Soxhlet extractions were performed using 100 ml of hexane, and temperature of 180 ºC. Extractions by fluid supercritical were performed at conditions of 200 bar, 70°C, and supercritical CO2 flow-rate of 3 g/min for 1-3 hours. The extracts obtained were quantified using Gas chromatography-mass spectrometry (GC/MS). The conventional extractions were made according to factorial experimental planning technique 22, with aim of study the influence of two variables of process extraction for the Soxhlet method: contaminant concentration and extraction time for obtain a maximum removal of PCB in the materials. The extractions for Soxhlet method were efficient for extraction of PCBs in soil and wood in both solvent studied (hexane and ethanol). In the experimental extraction in soils, the better efficient of removal of PCBs using ethanol as solvent was 81.3% than 95% for the extraction using hexane as solvent, for equal time of extraction. The results of the extraction with wood showed statistically it that there is not difference between the extractions in both solvent studied. The supercritical fluid extraction in the conditions studied showed better efficiency in the extraction of PCBs in the wood matrix than in soil, for two hours extractions the obtain percentual of 43.9 ± 0.5 % for the total of PCBs extracted in the soils against 95.1 ± 0,5% for the total of PCBs extracted in the wood. The results demonstrated that the extractions were satisfactory for both technical studied

Monitoramento em tempo real de processos fermentativos por espectroscopia no infravermelho próximo (NIRS)

A chemical process optimization and control is strongly correlated with the quantity of information can be obtained from the system. In biotechnological processes, where the transforming agent is a cell, many variables can interfere in the process, leading to changes in the microorganism metabolism and affecting the quantity and quality of final product. Therefore, the continuously monitoring of the variables that interfere in the bioprocess, is crucial to be able to act on certain variables of the system, keeping it under desirable operational conditions and control. In general, during a fermentation process, the analysis of important parameters such as substrate, product and cells concentration, is done off-line, requiring sampling, pretreatment and analytical procedures. Therefore, this steps require a significant run time and the use of high purity chemical reagents to be done. In order to implement a real time monitoring system for a benchtop bioreactor, these study was conducted in two steps: (i) The development of a software that presents a communication interface between bioreactor and computer based on data acquisition and process variables data recording, that are pH, temperature, dissolved oxygen, level, foam level, agitation frequency and the input setpoints of the operational parameters of the bioreactor control unit; (ii) The development of an analytical method using near-infrared spectroscopy (NIRS) in order to enable substrate, products and cells concentration monitoring during a fermentation process for ethanol production using the yeast Saccharomyces cerevisiae. Three fermentation runs were conducted (F1, F2 and F3) that were monitored by NIRS and subsequent sampling for analytical characterization. The data obtained were used for calibration and validation, where pre-treatments combined or not with smoothing filters were applied to spectrum data. The most satisfactory results were obtained when the calibration models were constructed from real samples of culture medium removed from the fermentation assays F1, F2 and F3, showing that the analytical method based on NIRS can be used as a fast and effective method to quantify cells, substrate and products concentration what enables the implementation of insitu real time monitoring of fermentation processes

Aplicação e análise de metodologia de deterioração ambiental em micro-bacia do seridó potiguar

In the contemporary world to the deterioration of semi-arid areas of the planet has been the focus of media attention and the scientific community. Brazil has a semiarid, considered the most problematic of the world, either by pressure from physical factors, whether as a result of misguided public policies, has over time been suffering from the consequences of a deterioration that expands over the years. Methodologies, that amidst the problems of semi-arid, come against the deteriorating local, have a good chance to be reapplied in other contexts around the world. This research, based on methodological model for analyzing environmental deterioration, introduced and examined the applicability of the methodology in the semi-arid region of Rio Grande do Norte - Brazil. Although the results provide guidelines for the introduction of underground dams, the application of the methodology was ineffective, given the high rates of forest cover that gave low values for the physical diagnosis conservationist

Números complexos: uma proposta de mudança metodológica para uma aprendizagem significativa no ensino médio

This work presents a proposal of a methodological change to the teaching and learning of the complex numbers in the Secondary education. It is based on the inquiries and difficulties of students detected in the classrooms about the teaching of complex numbers and a questioning of the context of the mathematics teaching - that is the reason of the inquiry of this dissertation. In the searching for an efficient learning and placing the work as a research, it is presented a historical reflection of the evolution of the concept of complex numbers pointing out their more relevant focuses, such as: symbolic, numeric, geometrical and algebraic ones. Then, it shows the description of the ways of the research based on the methodology of the didactic engineering. This one is developed from the utilization of its four stages, where in the preliminary analysis stage, two data surveys are presented: the first one is concerning with the way of presenting the contents of the complex numbers in math textbooks, and the second one is concerning to the interview carried out with High school teachers who work with complex numbers in the practice of their professions. At first, in the analysis stage, it is presented the prepared and organized material to be used in the following stage. In the experimentation one, it is presented the carrying out process that was made with the second year High school students in the Centro Federal de Educação tecnológica do Rio Grande do Norte CEFET-RN. At the end, it presents, in the subsequent and validation stages, the revelation of the obtained results from the observations made in classrooms in the carrying out of the didactic sequence, the students talking and the data collection

O Brasil n o berço da desigualdade: uma abordagem analítica sobre os significados das fotografias de Sebastião Salgado

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Validação de método analítico por espectrofotometria UV para sistema emulsionado lipídico contendo benznidazol

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)