938 resultados para Transfection


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oncogenic retroviruses carry coding sequences that are transduced from cellular protooncogenes. Natural transduction involves two nonhomologous recombinations and is thus extremely rare. Since transduction has never been reproduced experimentally, its mechanism has been studied in terms of two hypotheses: (i) the DNA model, which postulates two DNA recombinations, and (ii) the RNA model, which postulates a 5' DNA recombination and a 3' RNA recombination occurring during reverse transcription of viral and protooncogene RNA. Here we use two viral DNA constructs to test the prediction of the DNA model that the 3' DNA recombination is achieved by conventional integration of a retroviral DNA 3' of the chromosomal protooncogene coding region. For the DNA model to be viable, such recombinant viruses must be infectious without the purportedly essential polypurine tract (ppt) that precedes the 3' long terminal repeat (LTR) of all retroviruses. Our constructs consist of a ras coding region from Harvey sarcoma virus which is naturally linked at the 5' end to a retroviral LTR and artificially linked at the 3' end either directly (construct NdN) or by a cellular sequence (construct SU) to the 5' LTR of a retrovirus. Both constructs lack the ppt, and the LTR of NdN even lacks 30 nucleotides at the 5' end. Both constructs proved to be infectious, producing viruses at titers of 10(5) focus-forming units per ml. Sequence analysis proved that both viruses were colinear with input DNAs and that NdN virus lacked a ppt and the 5' 30 nucleotides of the LTR. The results indicate that DNA recombination is sufficient for retroviral transduction and that neither the ppt nor the complete LTR is essential for retrovirus replication. DNA recombination explains the following observations by others that cannot be reconciled with the RNA model: (i) experimental transduction is independent of the packaging efficiency of viral RNA, and (ii) experimental transduction may invert sequences with respect to others, as expected for DNA recombination during transfection.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Em estudos de terapia gênica e vacinação por DNA, a eficiência e a segurança dos vetores que transportam o material genético terapêutico possuem papel fundamental. Vetores não virais são considerados mais seguros, mas menos eficientes em relação aos vetores virais. Em parte, isso se deve à falta de estudos sistemáticos e comparativos no que diz respeito às características físico-químicas desses vetores quando em soluções biológicas e o efeito delas sobre a eficiência de entrega gênica. O objetivo deste trabalho é avaliar o efeito do pH, da força iônica e do tipo tampão de complexação sobre as características físico-químicas de nanopartículas pDNA-protamina e pDNA-protamina-lipofectamina, visando à entrega gênica para diferentes linhagens celulares. Para isso, nanopartículas formadas em diferentes condições foram caracterizadas através de ensaios de espalhamento dinâmico de luz (DLS) e potencial zeta. Os estudos indicaram que o pH, a força iônica, o tipo de tampão e a presença de meio de cultura e soro no ambiente de complexação alteram significativamente o tamanho, a polidispersidade e o potencial zeta das partículas formadas. Finalmente, buscou-se avaliar o efeito dessas características sobre a eficiência de transfecção in vitro de células de macrófagos IC21 e células HeLa. Os estudos de transfecção em células Hela indicam que tanto a composição como as condições de formação das partículas influenciam significativamente a eficiência de transfecção.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014

Relevância:

10.00% 10.00%

Publicador:

Resumo:

La déficience intellectuelle est la cause d’handicap la plus fréquente chez l’enfant. De nombreuses évidences convergent vers l’idée selon laquelle des altérations dans les gènes synaptiques puissent expliquer une fraction significative des affections neurodéveloppementales telles que la déficience intellectuelle ou encore l’autisme. Jusqu’à récemment, la majorité des mutations associées à la déficience intellectuelle a été liée au chromosome X ou à la transmission autosomique récessive. D’un autre côté, plusieurs études récentes suggèrent que des mutations de novo dans des gènes à transmission autosomique dominante, requis dans les processus de la plasticité synaptique peuvent être à la source d’une importante fraction des cas de déficience intellectuelle non syndromique. Par des techniques permettant la capture de l’exome et le séquençage de l’ADN génomique, notre laboratoire a précédemment reporté les premières mutations pathogéniques dans le gène à transmission autosomique dominante SYNGAP1. Ces dernières ont été associées à des troubles comportementaux tels que la déficience intellectuelle, l’inattention, des problèmes d’humeur, d’impulsivité et d’agressions physiques. D’autres patients sont diagnostiqués avec des troubles autistiques et/ou des formes particulières d’épilepsie généralisée. Chez la souris, le knock-out constitutif de Syngap1 (souris Syngap1+/-) résulte en des déficits comme l’hyperactivité locomotrice, une réduction du comportement associée à l’anxiété, une augmentation du réflexe de sursaut, une propension à l’isolation, des problèmes dans le conditionnement à la peur, des troubles dans les mémoires de travail, de référence et social. Ainsi, la souris Syngap1+/- représente un modèle approprié pour l’étude des effets délétères causés par l’haploinsuffisance de SYNGAP1 sur le développement de circuits neuronaux. D’autre part, il est de première importance de statuer si les mutations humaines aboutissent à l’haploinsuffisance de la protéine. SYNGAP1 encode pour une protéine à activité GTPase pour Ras. Son haploinsuffisance entraîne l’augmentation des niveaux d’activité de Ras, de phosphorylation de ERK, cause une morphogenèse anormale des épines dendritiques et un excès dans la concentration des récepteurs AMPA à la membrane postsynaptique des neurones excitateurs. Plusieurs études suggèrent que l’augmentation précoce de l’insertion des récepteurs AMPA au sein des synapses glutamatergiques contribue à certains phénotypes observés chez la souris Syngap1+/-. En revanche, les conséquences de l’haploinsuffisance de SYNGAP1 sur les circuits neuronaux GABAergiques restent inconnues. Les enjeux de mon projet de PhD sont: 1) d’identifier l’impact de mutations humaines dans la fonction de SYNGAP1; 2) de déterminer si SYNGAP1 contribue au développement et à la fonction des circuits GABAergiques; 3) de révéler comment l’haploinsuffisance de Syngap1 restreinte aux circuits GABAergiques affecte le comportement et la cognition. Nous avons publié les premières mutations humaines de type faux-sens dans le gène SYNGAP1 (c.1084T>C [p.W362R]; c.1685C>T [p.P562L]) ainsi que deux nouvelles mutations tronquantes (c.2212_2213del [p.S738X]; c.283dupC [p.H95PfsX5]). Ces dernières sont toutes de novo à l’exception de c.283dupC, héritée d’un père mosaïque pour la même mutation. Dans cette étude, nous avons confirmé que les patients pourvus de mutations dans SYNGAP1 présentent, entre autre, des phénotypes associés à des troubles comportementaux relatifs à la déficience intellectuelle. En culture organotypique, la transfection biolistique de l’ADNc de Syngap1 wild-type dans des cellules pyramidales corticales réduit significativement les niveaux de pERK, en fonction de l’activité neuronale. Au contraire les constructions plasmidiques exprimant les mutations W362R, P562L, ou celle précédemment répertoriée R579X, n’engendre aucun effet significatif sur les niveaux de pERK. Ces résultats suggèrent que ces mutations faux-sens et tronquante résultent en la perte de la fonction de SYNGAP1 ayant fort probablement pour conséquences d’affecter la régulation du développement cérébral. Plusieurs études publiées suggèrent que les déficits cognitifs associés à l’haploinsuffisance de SYNGAP1 peuvent émerger d’altérations dans le développement des neurones excitateurs glutamatergiques. Toutefois, si, et auquel cas, de quelle manière ces mutations affectent le développement des interneurones GABAergiques résultant en un déséquilibre entre l’excitation et l’inhibition et aux déficits cognitifs restent sujet de controverses. Par conséquent, nous avons examiné la contribution de Syngap1 dans le développement des circuits GABAergiques. A cette fin, nous avons généré une souris mutante knockout conditionnelle dans laquelle un allèle de Syngap1 est spécifiquement excisé dans les interneurones GABAergiques issus de l’éminence ganglionnaire médiale (souris Tg(Nkx2.1-Cre);Syngap1flox/+). En culture organotypique, nous avons démontré que la réduction de Syngap1 restreinte aux interneurones inhibiteurs résulte en des altérations au niveau de leur arborisation axonale et dans leur densité synaptique. De plus, réalisés sur des coupes de cerveau de souris Tg(Nkx2.1-Cre);Syngap1flox/+, les enregistrements des courants inhibiteurs postsynaptiques miniatures (mIPSC) ou encore de ceux évoqués au moyen de l’optogénétique (oIPSC) dévoilent une réduction significative de la neurotransmission inhibitrice corticale. Enfin, nous avons comparé les performances de souris jeunes adultes Syngap1+/-, Tg(Nkx2.1-Cre);Syngap1flox/+ à celles de leurs congénères contrôles dans une batterie de tests comportementaux. À l’inverse des souris Syngap1+/-, les souris Tg(Nkx2.1-Cre);Syngap1flox/+ ne présentent pas d’hyperactivité locomotrice, ni de comportement associé à l’anxiété. Cependant, elles démontrent des déficits similaires dans la mémoire de travail et de reconnaissance sociale, suggérant que l’haploinsuffisance de Syngap1 restreinte aux interneurones GABAergiques dérivés de l’éminence ganglionnaire médiale récapitule en partie certains des phénotypes cognitifs observés chez la souris Syngap1+/-. Mes travaux de PhD établissent pour la première fois que les mutations humaines dans le gène SYNGAP1 associés à la déficience intellectuelle causent la perte de fonction de la protéine. Mes études dévoilent, également pour la première fois, l’influence significative de ce gène dans la régulation du développement et de la fonction des interneurones. D’admettre l’atteinte des cellules GABAergiques illustre plus réalistement la complexité de la déficience intellectuelle non syndromique causée par l’haploinsuffisance de SYNGAP1. Ainsi, seule une compréhension raffinée de cette condition neurodéveloppementale pourra mener à une approche thérapeutique adéquate.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Le co-transporteur KCC2 spécifique au potassium et chlore a pour rôle principal de réduire la concentration intracellulaire de chlore, entraînant l’hyperpolarisation des courants GABAergic l’autorisant ainsi à devenir inhibiteur dans le cerveau mature. De plus, il est aussi impliqué dans le développement des synapses excitatrices, nommées aussi les épines dendritiques. Le but de notre projet est d’étudier l’effet des modifications concernant l'expression et la fonction de KCC2 dans le cortex du cerveau en développement dans un contexte de convulsions précoces. Les convulsions fébriles affectent environ 5% des enfants, et ce dès la première année de vie. Les enfants atteints de convulsions fébriles prolongées et atypiques sont plus susceptibles à développer l’épilepsie. De plus, la présence d’une malformation cérébrale prédispose au développement de convulsions fébriles atypiques, et d’épilepsie du lobe temporal. Ceci suggère que ces pathologies néonatales peuvent altérer le développement des circuits neuronaux irréversiblement. Cependant, les mécanismes qui sous-tendent ces effets ne sont pas encore compris. Nous avons pour but de comprendre l'impact des altérations de KCC2 sur la survenue des convulsions et dans la formation des épines dendritiques. Nous avons étudié KCC2 dans un modèle animal de convulsions précédemment validé, qui combine une lésion corticale à P1 (premier jour de vie postnatale), suivie d'une convulsion induite par hyperthermie à P10 (nommés rats LHS). À la suite de ces insultes, 86% des rats mâles LHS développent l’épilepsie à l’âge adulte, au même titre que des troubles d’apprentissage. À P20, ces animaux presentent une augmentation de l'expression de KCC2 associée à une hyperpolarisation du potentiel de réversion de GABA. De plus, nous avons observé des réductions dans la taille des épines dendritiques et l'amplitude des courants post-synaptiques excitateurs miniatures, ainsi qu’un déficit de mémoire spatial, et ce avant le développement des convulsions spontanées. Dans le but de rétablir les déficits observés chez les rats LHS, nous avons alors réalisé un knock-down de KCC2 par shARN spécifique par électroporation in utero. Nos résultats ont montré une diminution de la susceptibilité aux convulsions due à la lésion corticale, ainsi qu'une restauration de la taille des épines. Ainsi, l’augmentation de KCC2 à la suite d'une convulsion précoce, augmente la susceptibilité aux convulsions modifiant la morphologie des épines dendritiques, probable facteur contribuant à l’atrophie de l’hippocampe et l’occurrence des déficits cognitifs. Le deuxième objectif a été d'inspecter l’effet de la surexpression précoce de KCC2 dans le développement des épines dendritiques de l’hippocampe. Nous avons ainsi surexprimé KCC2 aussi bien in vitro dans des cultures organotypiques d’hippocampe, qu' in vivo par électroporation in utero. À l'inverse des résultats publiés dans le cortex, nous avons observé une diminution de la densité d’épines dendritiques et une augmentation de la taille des épines. Afin de confirmer la spécificité du rôle de KCC2 face à la région néocorticale étudiée, nous avons surexprimé KCC2 dans le cortex par électroporation in utero. Cette manipulation a eu pour conséquences d’augmenter la densité et la longueur des épines synaptiques de l’arbre dendritique des cellules glutamatergiques. En conséquent, ces résultats ont démontré pour la première fois, que les modifications de l’expression de KCC2 sont spécifiques à la région affectée. Ceci souligne les obstacles auxquels nous faisons face dans le développement de thérapie adéquat pour l’épilepsie ayant pour but de moduler l’expression de KCC2 de façon spécifique.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background. Low back pain is an increasing global health problem, which is associated with intervertebral disc (IVD) damage and degeneration. Major changes occur in the nucleus pulposus (NP), with the degradation of the extracellular matrix (ECM).1 Further studies showed that growth factors from transforming growth factor β (TGFβ) and bone morphogenic proteins (BMP) family may induce chondrogenic differentiation of mesenchymal stem cells (MSC).2 Focusing on non-viral gene therapies and their possible translation into the clinics, we investigated if GDF6 (syn. BMP13 or CDMP2) can induce regeneration of degraded NP. We hypothesized that IVD transfected with plasmid over-expressing GDF6 also up-regulates other NP- and chondrogenic cell markers and enhances ECM deposition. Methods. Bovine nucleus pulposus (bNPC) and annulus fibrosus cells (bAFC) were harvested from bovine coccygeal IVD. Primary cells were then electroporized with plasmid GDF6 (Origene, vector RG211366) by optimizing parameters using the Neon Transfection system (Life Technologies, Basel). After transfection, cells were cultured in 2D monolayer or 3D alginate beads for 7, 14 or 21 days. Transfection efficiency of pGDF6 was analyzed by immunohistochemistry and fluorescent microscopy. Cell phenotype was quantified by real-time RT-PCR. To test a non-viral gene therapy applied directly to 3D whole organ culture, coccygeal bovine IVDs were harvested as previously described. Bovine IVDs were transfected by injection of plasmid GDF6 into the center. Electroporation was performed with ECM830 Square Wave Electroporation System (Harvard Apparatus, MA) using 2-needle array electrode or tweezertrodes. 72 h after tranfection discs were fixed and cryosectioned and analyzed by immunofluorescence against GDF6. Results. RT-PCR and immunohistochemistry confirmed up-regulation of GFP and GDF6 in the primary bNPC/bAFC culture. The GFP-tagged GDF6 protein, however, was not visible, possibly due to failure of dimer formation as a result of fusion structure. Organ IVD culture transfection revealed GDF6 positive staining in the center of the disc using 2-needle array electrode. Results from tweezertrodes did not show any GDF6 positive cells. Conclusion. Non-viral transfection is an appealing approach for gene therapy as it fulfills the translational safety aspects of transiency and lacks the toxic effects of viral transduction. We identified novel parameters to successfully transfect primary bovine IVD cells. For transfection of whole IVD explants electroporation parameters need to be further optimized. Acknowledgements. This project was funded by the Lindenhof Foundation (Funds “Research & Teaching”) Project no. 13-02-F. The imaging part of this study was performed with the facility of the Microscopy Imaging Center (MIC), University of Bern. References. Roughly PJ (2004): Spine (Phila), 29:2691-2699 Clarke LE, McConell JC, Sherratt MJ, Derby B, Richardson SM, Hoyland JA (2014), Arthritis Research & Therapy, 16:R67

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The pre-erythrocytic (PE) phase of malaria infection, which extends from injection of sporozoites into the skin to the release of the first generation of merozoites, has traditionally been the 'black box' of the Plasmodium life cycle. However, since the advent of parasite transfection technology 13 years ago, our understanding of the PE phase in cellular and molecular terms has dramatically improved. Here, we review and comment on the major developments in the field in the past five years. Progress has been made in many diverse areas, including identifying and characterizing new proteins of interest, imaging parasites in vivo, understanding better the cell biology of hepatocyte infection and developing new vaccines against PE stages of the parasite.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Le co-transporteur KCC2 spécifique au potassium et chlore a pour rôle principal de réduire la concentration intracellulaire de chlore, entraînant l’hyperpolarisation des courants GABAergic l’autorisant ainsi à devenir inhibiteur dans le cerveau mature. De plus, il est aussi impliqué dans le développement des synapses excitatrices, nommées aussi les épines dendritiques. Le but de notre projet est d’étudier l’effet des modifications concernant l'expression et la fonction de KCC2 dans le cortex du cerveau en développement dans un contexte de convulsions précoces. Les convulsions fébriles affectent environ 5% des enfants, et ce dès la première année de vie. Les enfants atteints de convulsions fébriles prolongées et atypiques sont plus susceptibles à développer l’épilepsie. De plus, la présence d’une malformation cérébrale prédispose au développement de convulsions fébriles atypiques, et d’épilepsie du lobe temporal. Ceci suggère que ces pathologies néonatales peuvent altérer le développement des circuits neuronaux irréversiblement. Cependant, les mécanismes qui sous-tendent ces effets ne sont pas encore compris. Nous avons pour but de comprendre l'impact des altérations de KCC2 sur la survenue des convulsions et dans la formation des épines dendritiques. Nous avons étudié KCC2 dans un modèle animal de convulsions précédemment validé, qui combine une lésion corticale à P1 (premier jour de vie postnatale), suivie d'une convulsion induite par hyperthermie à P10 (nommés rats LHS). À la suite de ces insultes, 86% des rats mâles LHS développent l’épilepsie à l’âge adulte, au même titre que des troubles d’apprentissage. À P20, ces animaux presentent une augmentation de l'expression de KCC2 associée à une hyperpolarisation du potentiel de réversion de GABA. De plus, nous avons observé des réductions dans la taille des épines dendritiques et l'amplitude des courants post-synaptiques excitateurs miniatures, ainsi qu’un déficit de mémoire spatial, et ce avant le développement des convulsions spontanées. Dans le but de rétablir les déficits observés chez les rats LHS, nous avons alors réalisé un knock-down de KCC2 par shARN spécifique par électroporation in utero. Nos résultats ont montré une diminution de la susceptibilité aux convulsions due à la lésion corticale, ainsi qu'une restauration de la taille des épines. Ainsi, l’augmentation de KCC2 à la suite d'une convulsion précoce, augmente la susceptibilité aux convulsions modifiant la morphologie des épines dendritiques, probable facteur contribuant à l’atrophie de l’hippocampe et l’occurrence des déficits cognitifs. Le deuxième objectif a été d'inspecter l’effet de la surexpression précoce de KCC2 dans le développement des épines dendritiques de l’hippocampe. Nous avons ainsi surexprimé KCC2 aussi bien in vitro dans des cultures organotypiques d’hippocampe, qu' in vivo par électroporation in utero. À l'inverse des résultats publiés dans le cortex, nous avons observé une diminution de la densité d’épines dendritiques et une augmentation de la taille des épines. Afin de confirmer la spécificité du rôle de KCC2 face à la région néocorticale étudiée, nous avons surexprimé KCC2 dans le cortex par électroporation in utero. Cette manipulation a eu pour conséquences d’augmenter la densité et la longueur des épines synaptiques de l’arbre dendritique des cellules glutamatergiques. En conséquent, ces résultats ont démontré pour la première fois, que les modifications de l’expression de KCC2 sont spécifiques à la région affectée. Ceci souligne les obstacles auxquels nous faisons face dans le développement de thérapie adéquat pour l’épilepsie ayant pour but de moduler l’expression de KCC2 de façon spécifique.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Thesis (Ph.D.)--University of Washington, 2016-06

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To increase transient expression of recombinant proteins in Chinese hamster ovary cells, we have engineered their protein synthetic capacity by directed manipulation of mRNA translation initiation. To control this process we constructed a nonphosphorylatable Ser51Ala site-directed mutant of eIF2, a subunit of the trimeric eIF2 complex that is implicated in regulation of the global rate of mRNA translation initiation in eukaryotic cells. Phosphorylation of eIF2 by protein kinases inhibits eIF2 activity and is known to increase as cells perceive a range of stress conditions. Using single-and dual-gene plasmids introduced into CHO cells by electroporation, we found that transient expression of the eIF2 Ser51Ala mutant with firefly luciferase resulted in a 3-fold increase in reporter activity, relative to cells transfected with reporter only. This effect was maintained in transfected cells for at least 48 h after transfection. Expression of the wild-type eIF2 protein had no such effect. Elevated luciferase activity was associated with a reduction in the level of eIF2 phosphorylation in cells transfected with the mutant eIF2 construct. Transfection of CHO cells with the luciferase-only construct resulted in a marked decrease in the global rate of protein synthesis in the whole cell population 6 h post-transfection. However, expression of the mutant Ser51Ala or wild-type eIF2 proteins restored the rate of protein synthesis in transfected cells to a level equivalent to or exceeding that of control cells. Associated with this, entry of plasmid DNA into cells during electroporation was visualized by confocal microscopy using a rhodamine-labeled plasmid construct expressing green fluorescent protein. Six hours after transfection, plasmid DNA was present in all cells, albeit to a variable extent. These data suggest that entry of naked DNA into the cell itself functions to inhibit protein synthesis by signaling mechanisms affecting control of mRNA translation by eIF2. This work therefore forms the basis of a rational strategy to generically up-regulate transient expression of recombinant proteins by simultaneous host cell engineering.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Ataxia-oculomotor apraxia (AOA1) is a neurological disorder with symptoms that overlap those of ataxia-telangiectasia, a syndrome characterized by abnormal responses to double-strand DNA breaks and genome instability. The gene mutated in AOA1, APTX, is predicted to code for a protein called aprataxin that contains domains of homology with proteins involved in DNA damage signalling and repair. We demonstrate that aprataxin is a nuclear protein, present in both the nucleoplasm and the nucleolus. Mutations in the APTX gene destabilize the aprataxin protein, and fusion constructs of enhanced green fluorescent protein and aprataxin, representing deletions of putative functional domains, generate highly unstable products. Cells from AOA1 patients are characterized by enhanced sensitivity to agents that cause single-strand breaks in DNA but there is no evidence for a gross defect in single-strand break repair. Sensitivity to hydrogen peroxide and the resulting genome instability are corrected by transfection with full-length aprataxin cDNA. We also demonstrate that aprataxin interacts with the repair proteins XRCC1, PARP-1 and p53 and that it co-localizes with XRCC1 along charged particle tracks on chromatin. These results demonstrate that aprataxin influences the cellular response to genotoxic stress very likely by its capacity to interact with a number of proteins involved in DNA repair.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have previously developed replicon vectors derived from the Australian flavivirus Kunjin that have a unique noncytopathic nature and have been shown to direct prolonged high-level expression of encoded heterologous genes in vitro and in vivo and to induce strong and long-lasting immune responses to encoded immunogens in mice. To facilitate further applications of these vectors in the form of virus-like particles (VLPs), we have now generated a stable BHK packaging cell line, tetKUNCprME, carrying a Kunjin structural gene cassette under the control of a tetracycline-inducible promoter. Withdrawal of tetracycline from the medium resulted in production of Kunjin structural proteins that were capable of packaging transfected and self-amplified Kunjin replicon RNA into the secreted VLPs at titers of up to 1.6 x 10(9) VLPs per ml. Furthermore, secreted KUN replicon VLPs from tetKUNCprME cells could be harvested continuously for as long as 10 days after RNA transfection, producing a total yield of more than 1010 VLPs per 106 transfected cells. Passaging of VLPs on Vero cells or intracerebral injection into 2- to 4-day-old suckling mice illustrated the complete absence of any infectious Kunjin virus. tetKUNCprME cells were also capable of packaging replicon RNA from closely and distantly related flaviviruses, West Nile virus and dengue virus type 2, respectively. The utility of high-titer KUN replicon VLPs was demonstrated by showing increasing CD8(+)-T-cell responses to encoded foreign protein with increasing doses of KUN VLPs. A single dose of 2.5 x 10(7) VLPs carrying the human respiratory syncytial virus M2 gene induced 1,400 CD8 T cells per 10(6) splenocytes in an ex vivo gamma interferon enzyme-linked immunospot assay. The packaging cell line thus represents a significant advance in the development of the noncytopathic Kunjin virus replicon-based gene expression system and may be widely applicable to the basic studies of flavivirus RNA packaging and virus assembly as well as to the development of gene expression systems based on replicons from different flaviviruses.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Exogenous transfer RNAs (tRNAs) favor translation of bovine papillomavirus 1 wild-type (wt) L1 mRNA in in vitro translation systems (Zhou et al. 1999, J. Virol., 73, 4972-4982). We, therefore, investigated whether papillomavirus (PV) wt L1 protein expression could be enhanced in eukaryotic cells following exogenous tRNA supplementation. Both Chinese hamster ovary (CHO) and Cos1 cells, transfected with PV1 wt L1 genes, effectively transcribed the genes but did not translate them. However, L1 protein translation was demonstrated following co-transfection with the L1 gene and a gene expressing tRNA(Ser)(CGA). Cell lines, stably transfected with a bovine papillomavirus 1 (BPV1) wt L1 expression construct, produced L1 protein after the transfection of the tRNA(Ser)(CGA) gene, but not following the transfection with basal vectors, suggesting that tRNA(Ser)(CGA) gene enhanced wt L1 translation as a result of endogenous tRNA alterations and phosphorylation of translation initiation factors elF4E and elF2alpha in the tRNA(Ser)(CGA) transfected L1 cell lines. The tRNA(Ser)(CGA) gene expression significantly reduced translation of L1 proteins expressed from codon-modified (HB) PV L1 genes utilizing mammalian preferred codons, but had variable effects on translation of green fluorescent proteins (GFPs) expressed from six serine GFP variants. The changes of tRNA pools appear to match the codon composition of PV wt and HB L1 genes and serine GFP variants to regulate translation of their mRNAs. These findings demonstrate for the first time in eukaryotic cells that translation of the target genes can be differentially influenced by the provision of a single tRNA expression construct.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cultivation technologies promoting organization of mammalian cells in three dimensions are essential for gene-function analyses as well as drug testing and represent the first step toward the design of tissue replacements and bioartificial organs. Embedded in a three-dimensional environment, cells are expected to develop tissue-like higher order intercellular structures (cell-cell contacts, extracellular matrix) that orchestrate cellular functions including proliferation, differentiation, apoptosis, and angiogenesis with unmatched quality. We have refined the hanging drop cultivation technology to pioneer beating heart microtissues derived from pure primary rat and mouse cardiomyocyte cultures as well as mixed populations reflecting the cell type composition of rodent hearts. Phenotypic characterization combined with detailed analysis of muscle-specific cell traits, extracellular matrix components, as well as endogenous vascular endothelial growth factor (VEGF) expression profiles of heart microtissues revealed (1) a linear cell number-microtissue size correlation, (2) intermicrotissue superstructures, (3) retention of key cardiomyocyte-specific cell qualities, (4) a sophisticated extracellular matrix, and (5) a high degree of self-organization exemplified by the tendency of muscle structures to assemble at the periphery of these myocardial spheroids. Furthermore (6), myocardial spheroids support endogenous VEGF expression in a size-dependent manner that will likely promote vascularization of heart microtissues produced from defined cell mixtures as well as support connection to the host vascular system after implantation. As cardiomyocytes are known to be refractory to current transfection technologies we have designed lentivirus-based transduction strategies to lead the way for genetic engineering of myocardial microtissues in a clinical setting.