Could the Leukocyte X Chromosome Inactivation Pattern Be Extrapolated to Hair Bulbs?

Background: The androgen receptor gene is located on the X chromosome with a polymorphic tract of CAG repeats that is inversely correlated to the receptor`s transactivation activity. A short CAG tract is associated with hyperandrogenic disorders. In women, one of the X chromosomes is inactivated and the X chromosome inactivation (XCI) pattern varies among tissues. Previous studies of hyperandrogenic disorders only evaluated XCI in leukocytes. Objective: To evaluate whether the XCI pattern in leukocytes could be extrapolated to those in hair bulbs. Material: A total of 58 healthy women were used for this study. DNA was extracted from leukocytes (n = 58 women) and pubic (n = 53 women) and scalp hair (n = 21 women). Methods: Hpa II digested and undigested DNA samples underwent fluorescence PCR GeneScan (R) analysis. Results: A significant and positive correlation of XCI was found between leukocytes and hair bulbs. However, individual comparisons showed that 13 and 19% of the women presented a different leukocyte XCI pattern in pubic hair and similar in leukocytes and hair bulbs of normal women indicating that leukocyte DNA is useful for XCI analysis. However, the XCI pattern could vary among tissues from the same subject, indicating that care should be taken when extrapolating individual leukocyte XCI patterns to other tissue. Copyright (C) 2010 S. Karger AG, Basel

Hyaluronan in vaginal secretions: association with recurrent vulvovaginal candidiasis

OBJECTIVE: We evaluated whether vaginal concentrations of hyaluronan were altered in women with recurrent vulvovaginal candidiasis (RVVC). STUDY DESIGN: Lavage samples from 17 women with acute RVVC, 27 women who were receiving a maintenance antifungal regimen, and 24 control women were tested for hyaluronan and interleukin (IL)-6, IL-12, and IL-23 by enzyme-linked immunosorbent assay. RESULTS: Median vaginal hyaluronan concentrations were 33.8 ng/mL (range, 21.6-66.3 ng/mL) in women with acute RVVC, 15.0 ng/mL (range, 11.2-50.6 ng/mL) in women who were receiving maintenance therapy, and 4.2 ng/mL (range, 3.6-12.0 ng/mL) in control subjects (P <= .02). The vaginal hyaluronan concentration was 27.4 ng/mL (range, 15.4-37.7 ng/mL) when Candida was detected by microscopy and 9.5 ng/mL (range, 7.7-14.6 ng/mL) in microscopy-negative cases (P = .0354). Elevated hyaluronan levels were associated with itching plus burning (40.7 ng/mL) or itching plus discharge (42.1 ng/mL), as opposed to itching only (6.2 ng/mL; P = .0152). Hyaluronan and IL-6 levels were correlated (P = .0009). CONCLUSION: Hyaluronan release is a component of the host response to a candidal infection and may contribute to symptoms.

Cholestanol: A serum marker to guide LDL cholesterol-lowering therapy

Statins have been the mainstay of lipid-lowering therapy since their introduction. However, as lower LDL cholesterol targets are sought, adjunct therapies are becoming increasingly important. Few patients reach new targets with statin monotherapy. We propose that the cholestanol: cholesterol ratio can be used to guide lipid-lowering therapy and result in greater numbers of patients reaching target LDL cholesterol. By determining whether a patient is mainly a synthesizer or absorber of cholesterol, customized regimens can be used and are expected to improve patient outcomes and minimize costs of treatment. (c) 2005 Elsevier Ireland Ltd. All rights reserved.

Growth Hormone Receptor Exon 3 Isoforms and Their Implication in Growth Disorders and Treatment

Human recombinant growth hormone (hGH) has been used to treat short stature in several different conditions, but considerable inter-individual variation in short- and long-term growth response exists. Pharmacogenomics can provide important insights into hGH therapy. The GH receptor (GHR) is the first key molecule mediating GH action. In the past 3 years, a common GHR polymorphism reflecting the presence (GHRf1) or absence (GHRd3) of exon 3 has been under intensive investigation regarding its influence on the response to hGH therapy. Studies that evaluated response to GH treatment determined by these two GHR isoforms in children with GH deficiency, girls with Turner syndrome, children born small for gestational age and patients with acromegaly showed that patients carrying the GHRd3 allele demonstrated a greater GH sensitivity than patients homozygous for the GHRf1 allele. Other studies presented contradictory data, however, which may be caused by confounding factors such as small sample sizes and differences in experimental design. This GHR exon 3 genotype is the first identified genetic factor found to modulate the individual response to GH therapy. This article reviews the historical aspects and pharmacogenetic studies published to date in relation to this GHR polymorphism. The analyses of present and future validation studies may define the use of this and other polymorphisms in clinical practice, moving from pharmacogenetics to routine application and allowing individualization of hGH doses to optimize final outcome. Copyright (C) 2009 S. Karger AG, Basel

Effects of Perilipin (PLIN) Gene Variation on Metabolic Syndrome Risk and Weight Loss in Obese Children and Adolescents

Context: Genetic polymorphisms at the perilipin (PLIN) locus have been investigated for their potential utility as markers for obesity and metabolic syndrome (MS). We examined in obese children and adolescents (OCA) aged 7-14 yr the association of single-nucleotide polymorphisms (SNP) at the PLIN locus with anthropometric, metabolic traits, and weight loss after 20-wk multi-disciplinary behavioral and nutritional treatment without medication. Design: A total of 234 OCA [body mass index (BMI = 30.4 +/- 4.4 kg/m(2); BMI Z-score = 2.31 +/- 0.4) were evaluated at baseline and after intervention. We genotyped four SNPs (PLIN1 6209T -> C, PLIN4 11482G -> A, PLIN5 13041A -> G, and PLIN6 14995A -> T). Results: Allele frequencies were similar to other populations, PLIN1 and PLIN4 were in linkage disequilibrium (D` = 0.999; P < 0.001). At baseline, no anthropometric differences were observed, but minor allele A at PLIN4 was associated with higher triglycerides (111 +/- 49 vs. 94 +/- 42 mg/dl; P = 0.003), lower high-density lipoprotein cholesterol (40 +/- 9 vs. 44 +/- 10 mg/dl; P = 0.003) and higher homeostasis model assessment for insulin resistance (4.0 +/- 2.3 vs. 3.5 +/- 2.1; P +/- 0.015). Minor allele A at PLIN4 was associated with MS risk (age and sex adjusted) hazard ratio 2.4 (95% confidence interval = 1.1-4.9) for genotype GA and 3.5 (95% confidence interval = 1.2-9.9) for AA. After intervention, subjects carrying minor allele T at PLIN6 had increased weight loss (3.3 +/- 3.7 vs. 1.9 +/- 3.4 kg; P = 0.002) and increased loss of the BMI Z-score (0.23 +/- 0.18 vs. 0.18 +/- 0.15; P +/- 0.003). Due to group size, risk of by-chance findings cannot be excluded. Conclusion: The minor A allele at PLIN4 was associated with higher risk of MS at baseline, whereas the PLIN6 SNP was associated with better weight loss, suggesting that these polymorphisms may predict outcome strategies based on multidisciplinary treatment for OCA. (J Clin Endocrinol Metab 93: 4933-4940, 2008)

Maternal and neonatal interleukin-1 receptor antagonist genotype and pregnancy outcome in a population with a high rate of pre-term birth

Problem We evaluated associations between a length polymorphism in intron 2 of the gene coding for IL-1ra (gene symbol IL1RN) and pregnancy outcome in a population with a high rate of preterm birth. Method of study Subjects were pregnant women in Maceio, Brazil and their newborns. DNA was tested for IL1RN genotypes and alleles by gene amplification using primer pairs that spanned the polymorphic region. Every subject completed a detailed questionnaire. Results The frequency of allele 2 (IL1RN*2) carriage was elevated in mothers with a spontaneous preterm birth (SPTB) in the current pregnancy (P = 0.02) and also with a prior preterm delivery (P = .01). Both SPTB with intact membranes (P = 0.01) and SPTB preceded by pre-term pre-mature rupture of membranes (P = .03) were associated with IL1RN*2 carriage. A previous fetal demise was more than twice as prevalent in mothers positive for two copies of IL1RN*2. Conclusion Maternal carriage of IL1RN*2 increases susceptibility to inflammation-triggered spontaneous pre-term birth.

The common p450 oxidoreductase variant A503V is not a modifier gene for 21-hydroxylase deficiency

Context: 21-hydroxylase deficiency (21OHD) is a common genetic disorder caused by mutations in the CYP21A2 gene, which encodes the adrenal 21-hydroxylase, microsomal P450c21. CYP21A2 gene mutations generally correlate well with impaired P450c21 enzymatic activity and the clinical findings in 21OHD, but occasional discrepancies between genotype and phenotype suggest the effects of modifier genes. Mutations in P450 oxidoreductase (POR), the protein that transfers electrons from reduced nicotinamide adenine dinucleotide phosphate to all microsomal P450s, can ameliorate the 21OHD phenotype and, therefore, could be a modifier gene. Objectives: We sought to identify POR variants in patients with 21OHD having discordant phenotype and genotype, and to evaluate their effect on 21-hydroxylase activity. Patients and Methods: We determined the CYP21A2 genotypes of 313 Brazilian patients with 21OHD and correlated the genotype and phenotype. The POR gene was sequenced in 17 patients with discordant genotype and phenotype. Wild-type and A503V POR, and P450c21 were expressed in bacteria and reconstituted in vitro. Activities were assayed by conversion of [C-14] progesterone to deoxycorticosterone and [H-3]17-hydroxyprogesterone to 11-deoxycortisol, and assessed by thin layer chromatography and phosphorimaging. Results: The A503V POR variant was found in 10 of 30 alleles, the same ratio as in the normal population. There were no significant differences in Michaelis constant, maximum velocity and maximum velocity/Michaelis constant of 21-hydroxylase activity supported by wild-type and A503V POR. Conclusion: The only POR missense polymorphism found in atypical 21OHD patients was A503V. Although A503V reduces P450c17 enzymatic activity, it does not influence P450c21 activity, indicating that POR A503V does not modify the 21OHD phenotype.

The degree of external genitalia virilization in girls with 21-hydroxylase deficiency appears to be influenced by the CAG repeats in the androgen receptor gene

Background Women with 21-hydroxylase deficiency present much variability in external genitalia virilization, even among those with similar impairments of 21-hydroxylase (21OH) activity. Objective To evaluate if the number of CAG (nCAG) repeats of the androgen receptor gene influences the degree of external genitalia virilization in women with CYP21A2 mutations, grouped according to impairment of 21OH activity. Patients The nCAG was determined in 106 congenital adrenal hyperplasia (CAH) patients and in 302 controls. The patients were divided, according to their CYP21A2 genotypes, into Groups A and B, which confer total and severe impairment of 21OH activity, respectively. Methods The inactivation pattern of the X-chromosome was studied through genomic DNA digestion with Hpa II. The CAG repeat region was amplified by polymerase chain reaction (PCR) and analysed by GeneScan. Results The nCAG and the frequency of severe skewed X-inactivation did not differ between normal women and patients. The nCAG median in genotype A was 20.7 (IQR 2.3) for Prader I + II, 22.5 (3.6) for Prader III and 21 (2.9) for Prader IV + V (P < 0.05 for Prader III and Prader IV + V). The nCAG median in genotype B was 21.3 (1.1) for Prader I + II, 20.5 (2.9) for Prader III and 22 (2.8) for Prader IV + V (P > 0.05). A significant difference was found regarding the nCAG median in patients presenting Prader III from genotypes A and B. Conclusions We observed great variability in the degree of external genitalia virilization in both CYP21A2 genotypes, and we showed that the CAG repeats of the androgen receptor gene influences this phenotypic variability.

The Role of SRY Mutations in the Etiology of Gonadal Dysgenesis in Patients with 45,X/46,XY Disorder of Sex Development and Variants

Background: The potential involvement of SRY in abnormal gonadal development in 45,X/46,X,der(Y) patients was proposed following the identification of SRY mutations in a few patients with Turner syndrome (TS). However, its exact etiological role in gonadal dysgenesis in patients with Y chromosome mosaicisms has not yet been clarified. Aims: It was the aim of this study to screen for allelic variation in SRY in a large cohort of patients with disorders of sex development due to chromosomal abnormalities with 45, X/46, X, der(Y) karyotype. Patients: Twenty-seven patients, 14 with TS and 13 with mixed gonadal dysgenesis (MGD), harboring 45, X/46, X, der(Y) karyotypes were selected. Methods: Genomic DNA was extracted from peripheral blood leukocytes of all patients and from gonadal tissue in 4 cases. The SRY coding region was PCR amplified and sequenced. Results: We identified only 1 polymorphism (c.561C -> T) in a 45,X/46,XY MGD patient, which was detected in blood and in gonadal tissue. Conclusion: Our results indicate that mutations in SRY are rare findings in patients with Y chromosome mosaicisms. Therefore, a significant role of mutated SRY in the etiology of gonadal dysgenesis in patients harboring 45, X/46, XY karyotype and variants seems very unlikely. Copyright (C) 2010 S. Karger AG, Basel

Absence of GH-Releasing Hormone (GHRH) Mutations in Selected Patients with Isolated GH Deficiency

Context: Although numerous reports of mutations in GH1 and GHRHR (GHRH receptor) causing isolated GH deficiency (IGHD) have been published, mutations in GHRH itself have not been hitherto reported but are obvious candidates for GH deficiency. Objective: The aim of this study was to identify mutations in GHRH in a large cohort of patients with IGHD. Patients and Methods: DNA was isolated from 151 patients diagnosed with IGHD at national and international centers. Seventy-two patients fulfilled all the following criteria: severe short stature (height SD score <= -2.5), low peakGHafter stimulation (peak <= 5 ng/ml), eutopic posterior pituitary lobe, and absence of mutations in GH1 and GHRHR and therefore were strong candidates for GHRH mutations. The coding sequence and splice sites of GHRH were amplified by PCR with intronic primers and sequenced. Results: In five of 151 patients (four of 42 from Brazil), the GHRH c. 223 C>T, p. L75F change was identified in heterozygosity. This variant has been previously reported as a polymorphism and is more frequent in African than European and Asian populations. Six allelic variants (five novel) that do not predict change of amino acids or splice sites were identified in five patients: c. 147 C>T, p.S49S, IVS1 -70 G>A, IVS1 -74 T>C, IVS3 -47 del1, and IVS3 +7 G>A/IVS3 + 41 G>A. No functional mutations were found in this cohort. Conclusions: GHRH mutations were not identified in a selected cohort of patients with IGHD, suggesting that, if they exist, they may be an extremely rare cause of IGHD. Other, as-yet-unidentified genetic factors may be implicated in the genetic etiology of IGHD in our cohort. (J Clin Endocrinol Metab 96: E1457-E1460, 2011)

Loss of heterozygosity of the APC gene in oral squamous cell carcinoma

The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Juvenile onset systemic lupus erythematosus thyroid dysfunction: A subgroup with mild disease?

The aim of this study was to evaluate the frequency of thyroid dysfunction and thyroid antibodies in patients with juvenile onset Systemic Lupus Erythematosus (JOSLE) and its association with clinical and immunological features. Seventy-seven patients with JOSLE, 64 females, median age 19 years, were consecutively enrolled from March to December 2007. Clinical data related to thyroid dysfunction and lupus were obtained by chart review and patient interview. Serum levels of TSH, free T4, anti-thyroglobulin (TgAb), anti-thyroperoxidase (TPOAb), TRAb and lupus related autoantibodies were analyzed by standard techniques. Nine patients were diagnosed as hypothyroidism and 4 hyperthyroidism. 28% JOSLE patients had moderate/high titer of thyroid antibodies: 23% TgAb, 2.6% TPOAb and 3.9% TRAb. JOSLE patients with positive thyroid autoantibodies had higher frequency of anti-U1RNP antibodies than patients without these antibodies (40.9 vs. 14.5%, OR:0.25, CI:0.08-0.76, p = 0.017). Furthermore, renal/neurological/hematological involvement was less frequently observed in patients with hypothyroidism (55.6 vs. 87.5%, OR:0.18, CI:0.04-0.81, p = 0.035) and with thyroid antibodies (68.4 vs. 90.9%, OR:0.22, CI:0.06-0.82. p = 0.027) than in patients without these alterations. No association with PTPN22 polymorphism was found. In conclusion, JOSLE patients have high prevalence of subclinical hypothyroidism. The novel association of anti-thyroid antibodies with anti-U1RNP antibodies in JOSLE seems to identify a subgroup of patients with less life-threatening organ involvement. (C) 2009 Elsevier Ltd. All rights reserved.

Heterozygosity for the S180L Variant of MAL/TIRAP, a Gene Expressing an Adaptor Protein in the Toll-Like Receptor Pathway, Is Associated with Lower Risk of Developing Chronic Chagas Cardiomyopathy

Background. Chagas disease is caused by the protozoan parasite Trypanosoma cruzi. Among T. cruzi-infected individuals, only a subgroup develops severe chronic Chagas cardiomyopathy (CCC); the majority remain asymptomatic. T. cruzi displays numerous ligands for the Toll-like receptors (TLRs), which are an important component of innate immunity that lead to the transcription of proinflammatory cytokines by nuclear factor-kappa B. Because proinflammatory cytokines play an important role in CCC, we hypothesized that single-nucleotide polymorphisms (SNPs) in the genes that encode proteins in the TLR pathway could explain differential susceptibility to CCC among T. cruzi-infected individuals. Methods. For 169 patients with CCC and 76 T. cruzi-infected, asymptomatic individuals, we analyzed SNPs by use of polymerase chain reaction-restriction fragment length polymorphism analysis for the genes TLR1, TLR2, TLR4, TLR5, TLR9, and MAL/TIRAP, which encodes an adaptor protein. Results. Heterozygous carriers of the MAL/TIRAP variant S180L were more prevalent in the asymptomatic group (24 [32%] of 76 subjects) than in the CCC group (21 [12%] of 169) (chi(2) = 12.6; P = .0004 [adjusted P (P(c)) = .0084]; odds ratio [OR], 0.31 [95% confidence interval {CI}, 0.16-0.60]). Subgroup analysis showed a stronger association when asymptomatic patients were compared with patients who had severe CCC (i.e., patients with left-ventricular ejection fraction <= 40%) (chi(2) = 11.3; P = .0008 [P(c) = .017]; OR, 0.22 [95% CI, 0.09-0.56]) than when asymptomatic patients were compared with patients who had mild CCC (i.e., patients with left-ventricular ejection fraction >40%) (chi(2) = 7.7; P = .005 [P(c) = .11]; OR, 0.33 [95% CI, 0.15-0.73]). Conclusion. T. cruzi-infected individuals who are heterozygous for the MAL/TIRAP S180L variant that leads to a decrease in signal transduction upon ligation of TLR2 or TLR4 to their respective ligand may have a lower risk of developing CCC.

Sertraline vs. ELectrical Current Therapy for Treating Depression Clinical Trial - SELECT TDCS: Design, rationale and objectives

Background: Despite significant advancements in psychopharmacology, treating major depressive disorder (MDD) is still a challenge considering the efficacy, tolerability, safety, and economical costs of most antidepressant drugs. One approach that has been increasingly investigated is modulation of cortical activity with tools of non-invasive brain stimulation - such as transcranial magnetic stimulation and transcranial direct current stimulation (tDCS). Due to its profile, tDCS seems to be a safe and affordable approach. Methods and design: The SELECT TDCS trial aims to compare sertraline vs. tDCS in a double-blinded, randomized, factorial trial enrolling 120 participants to be allocated to four groups to receive sertraline + tDCS, sertraline, tDCS or placebo. Eligibility criteria are moderate-to-severe unipolar depression (Hamilton Depression Rating Scale >17) not currently on sertraline treatment. Treatment will last 6 weeks and the primary outcome is depression change in the Montgomery-Asberg Depression Rating Score (MADRS). Potential biological markers that mediate response, such as BDNF serum levels, Val66Met BDNF polymorphism, and heart rate variability will also be examined. A neuropsychological battery with a focus on executive functioning will be administered. Discussion: With this design we will be able to investigate whether tDCS is more effective than placebo in a sample of patients free of antidepressants and in addition, we will be able to secondarily compare the effect sizes of sertraline vs. tDCS and also the comparison between tDCS and combination of tDCS and sertraline. (C) 2010 Elsevier Inc. All rights reserved.