Validação de metodologia para a determinação simultânea dos antioxidantes sintéticos em óleos vegetais, margarinas e gorduras hidrogenadas por CLAE/UV

The use of antioxidants either to prevent or retard food's lipids oxidation was approved after inquires that verified their security within a daily intake limit. In this study, the methodology was developed and validated for the analysis of synthetic antioxidants: propylgallate (PG), tert-butylhydroquinone (TBHQ), butylhydroxyanisole (BHA), octylgallate (OG) and butylhydroxytoluene (BHT) in vegetables oils, margarine and hydrogenated fats by high performance liquid chromatographic. The methodology revealed itself efficient, with recovery rates above 90% for all antioxidant substances, besides good linearity in concentration range of 40-240 mg kg-1 (r = 0,999), repeatability with CV < 3,7% and limit of quantification 16.55, 10.32, 1.40, 3.76 and 9.30 mg/kg for BHT, BHA, PG, OG and TBHQ, respectively.

Glicoproteína-P, resistência a múltiplas drogas (MDR) e relação estrutura-atividade de moduladores

Multidrug resistance, MDR is a major obstacle for cancer chemotherapy. MDR can be reversed by drugs that vary in their chemical structure and main biological activity. Many efforts have been done to overcome MDR based on studies of structure-activity relationships and in this review we summarize some aspects of MDR mediated by P-glycoprotein (P-gp), as the most experimentally and clinically tested form of drug resistance. The most significant MDR mechanisms revealed until now are shortly discussed. Physicochemical and structural properties of MDR modulators, measures of the MDR reversal, and QSAR studies are included.

Otimização das condições de extração de saponinas em Ampelozizyphus amazonicus usando planejamento experimental e metodologia de superfície de resposta

This works describes the use of experimental design and surface response methodology for optimization of saponin extraction from Ampelozizyphus amazonicus. For this purpose, a method employing extraction based on maceration assisted by ultrasound technique was utilized. The following factors were studied: extraction length of time and solvent composition. The total saponin was determined by using a gravimetric method and the results expressed by their relative proportion to total crude extract. For the specific condition, 60% hydro-alcoholic solution and 18 minutes extraction length of time has shown the best results. This method can be useful for extraction of substances with biological importance

Avaliação da biodegradabilidade anaeróbia de resíduos da bovinocultura e da suinocultura

The biodegradability of animal wastes production was evaluated through a simplified methodology that allowed the verification of the applicability of anaerobic processes. The experiments were performed in bath reactors, with granular sludge of three origins: UASB reactor treating dairy effluent, UASB reactor treating swine effluent and UASB reactor treating effluent of slaughterhouse of poultry. The experiments (1) - dairy effluent and poultry slaughterhouse non-adapted sludge; (2) -swine effluent and poultry slaughterhouse non-adapted sludge; (3) - dairy effluent and poultry slaughterhouse adapted sludge; (4) - swine effluent and poultry slaughterhouse adapted sludge; (5) - dairy effluent and dairy sludge, and (6) - swine effluent and swine sludge were performed in Incubator Shaker, at a temperature of 35 °C, under agitation at a 150 rpm, for 5 minutes, every 1 hour. A substrat:biomass relationship of 0.5 was used. Kinetic models of Monod, Zero Order, First and Second Order were tested and it was verified that the First Order model provided the best adjustment. The apparent First Order kinetic parameter (k1) was estimated for the experiments 1; 2; 3; 4; 5, and 6, as 2.51 x 10-2; 2.49 x 10-2; 1.90 x 10-2; 3.09 x 10-2; 2.54 x 10-2; 4.09 x 10-2 h-1, respectively.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Prolongamento da amamentação após o primeiro ano de vida: argumentos das mães

This paper aims to identify and analyze the reasons pointed by mothers to prolong breastfeeding beyond the first year of the child s life. The study involved 40 mothers whose children were treated in the Preventive Program of Research and Dental Treatment Center for Special Patients - Dental School of Piracicaba - UNICAMP. The group consisted of mothers who prolonged the breastfeeding beyond the baby s first year of life. All mothers were surveyed by a researcher using a specific questionnaire. In order to avoid information loss, the interviews were taped, then transcripted. Results showed that the main cause of the extended breastfeeding was maternal pleasure. It was also observed that the mother and infant attachment favors prolonged breastfeeding occurrence. Further studies should be carried out for more accurate functional analyses of variable that lead to extend breastfeeding or to wean.

Implante coclear em crianças: a visão dos pais

The objective of this study was to analyze the point of view of parents in relation to the cochlear implant, their level of information concerning the implant, its risks and benefits, and their expectations towards their children's future. Ten parents of deaf children candidate for the cochlear implant at Unicamp's Clinical Hospital were interviewed. Based on a qualitative approach, a content analysis showed that the majority of parents seek the cure for deafness, and consequently, the acquisition of speech with the cochlear implant. For these families, the cochlear implant is seen both as the solution to their children's deafness and as a path for a better future. It has been evidenced that during the acquisition of knowledge about the implant, parents experienced anxiety and anguish when faced with the risks and benefits of the procedure, and the need to choose between performing and not performing the cochlear implant.

Resonancias discursivas y cortesía en prácticas de lecto-escritura

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

PREDIÇÃO DA ATIVIDADE DE ÁGUA E RELAÇÃO ENTRE A ATIVIDADE DE ÁGUA E A DEPRESSÃO DO PONTO DE CONGELAMENTO DE SUCOS DE FRUTAS

This work proposes to determine the water activity and the freezing point depression of tangerine, pineapple and lemon juices at various concentrations (10-55oBrix) and to achieve a correlation between these properties. The freezing point depression was determined with a LAKTRON cryoscope and common laboratory materials. The water activity was determined with a DECAGON CX-2 hygrometer in the temperature range of 15 to 30oC. With the results, the adjustment to CHEN (1987) water activity prediction equation to non-electrolyte mixtures was verified, through the calculation of the variation coefficient (CV). Being CV smaller than 3% for the proposed model, it can be said that the experimental data have adjusted well to the prediction equation. The water activity and the freezing point depression was correlated for tangerine, pineapple and lemon juices and r2 values were higher than 99%. Therefore, it is possible to obtain the water activity by knowing the freezing point depression of studied juices.

Desidratação osmótica de abacaxi aplicada à tecnologia de métodos combinados

The aim of this research was to optimize osmotic dehydration of pineapple, according to two criteria: maximize water loss and minimize solid gain. The process was made as an application to Combined Methods Technology, in which three preservation factors were combined: water activity, pH and chemical preservatives, all being applied at low levels, in order to get a product resembling non-processed fruit. The experiment was divided into three treatments, being: non-coated pineapple pieces (A), pieces coated with alginate (B) and coated with low-methoxyl pectin (C). Process involved the following main steps: enzymatic inactivation of fruit pieces; in treatments B and C, incorporation of their respective coatings; and osmotic dehydration, in sucrose syrup containing potassium sorbate and citric acid. Optimum conditions, determined from Response Surface Methodology, were the following: dehydration of fruit pieces coated by alginate, at 42-47° C, in sucrose syrup at 66-69° Brix, for 220 to 270 minutes. Results indicated that both coatings significantly affected the mass transfers of the process, reducing solid incorporation and increasing water loss; therefore, increasing weight loss and performance ratio (water loss: solid incorporation) took place. Water activity was not significantly affected by the coatings. The product obtained under optimum conditions was submitted to sensorial evaluation, and presented a good general acceptance. Moulds and yeasts countings indicated good microbiological stability of the product for at least 60 days at 30ºC.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Identidade social e auto conceito do dançarino em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeitos de diferentes protocolos de treinamento físico sobre o controle autonômico e cardiorrespiratório em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Em jogo a relação entre pesquisador e clube : futebol e processos grupais

Universidade Estadual de Campinas . Faculdade de Educação Física