Towards A Deeper Understanding Of Structural Biomass Recalcitrance Using Phase-contrast Tomography.

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

Development Of Egg Pc/cholesterol/α-tocopherol Liposomes With Ionic Gradients To Deliver Ropivacaine.

Ropivacaine (RVC) is an aminoamide local anesthetic widely used in surgical procedures. Studies with RVC encapsulated in liposomes and complexed in cyclodextrins have shown good results, but in order to use RVC for lengthy procedures and during the postoperative period, a still more prolonged anesthetic effect is required. This study therefore aimed to provide extended RVC release and increased upload using modified liposomes. Three types of vesicles were studied: (i) large multilamellar vesicle (LMV), (ii) large multivesicular vesicle (LMVV) and (iii) large unilamellar vesicle (LUV), prepared with egg phosphatidylcholine/cholesterol/α-tocopherol (4:3:0.07 mol%) at pH 7.4. Ionic gradient liposomes (inside: pH 5.5, pH 5.5 + (NH4)2SO4 and pH 7.4 + (NH4)2SO4) were prepared and showed improved RVC loading, compared to conventional liposomes (inside: pH 7.4). An high-performance liquid chromatography analytical method was validated for RVC quantification. The liposomes were characterized in terms of their size, zeta potential, polydispersion, morphology, RVC encapsulation efficiency (EE(%)) and in vitro RVC release. LMVV liposomes provided better performance than LMV or LUV. The best formulations were prepared using pH 5.5 (LMVV 5.5in) or pH 7.4 with 250 mM (NH4)2SO4 in the inner aqueous core (LMVV 7.4in + ammonium sulfate), enabling encapsulation of as much as 2% RVC, with high uptake (EE(%) ∼70%) and sustained release (∼25 h). The encapsulation of RVC in ionic gradient liposomes significantly extended the duration of release of the anesthetic, showing that this strategy could be a viable means of promoting longer-term anesthesia during surgical procedures and during the postoperative period.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Evaluation of simulated bone lesion in the head of the mandible by using multislice computed tomography

Conventional radiography has shown limitation in acquiring image of the ATM region, thus, computed tomography (CT) scanning has been the best option to the present date for diagnosis, surgical planning and treatment of bone lesions, owing to its specific properties. OBJECTIVE: The aim of the study was to evaluate images of simulated bone lesions at the head of the mandible by multislice CT. MATERIAL AND METHODS: Spherical lesions were made with dental spherical drills (sizes 1, 3, and 6) and were evaluated by using multislice CT (64 rows), by two observers in two different occasions, deploying two protocols: axial, coronal, and sagittal images, and parasagittal images for pole visualization (anterior, lateral, posterior, medial and superior). Acquired images were then compared with those lesions in the dry mandible (gold standard) to evaluate the specificity and sensibility of both protocols. Statistical methods included: Kappa statistics, validity test and chi-square test. Results demonstrated the advantage of associating axial, coronal, and sagittal slices with parasagittal slices for lesion detection at the head of the mandible. RESULTS: There was no statistically significant difference between the types of protocols regarding a particular localization of lesions at the poles. CONCLUSIONS: Protocols for the assessment of the head of the mandible were established to improve the visualization of alterations of each of the poles of the mandible's head. The anterior and posterior poles were better visualized in lateral-medial planes while lateral, medial and superior poles were better visualized in the anterior-posterior plane.

Two-dimensional gel electrophoretic protein profile analysis during seed development of Ocotea catharinensis: a recalcitrant seed species

The aim of the present work was to characterize changes in the protein profile throughout seed development in O. catharinensis, a recalcitrant species, by two-dimensional gel electrophoresis. Protein extraction was undertaken by using a thiourea/urea buffer, followed by a precipitation step with 10% TCA. Comparative analysis during seed development showed that a large number of proteins were exclusively detected in each developmental stage. The cotyledonary stage, which represents the transition phase between embryogenesis and the beginning of metabolism related to maturation, presents the highest number of stage-specific spots. Protein identification, through MS/MS analysis, resulted in the identification of proteins mainly related to oxidative metabolism and storage synthesis. These findings contribute to a better understanding of protein metabolism during seed development in recalcitrant seeds, besides providing information on established markers that could be useful in defining and improving somatic embryogenesis protocols, besides monitoring the development of somatic embryos in this species.

Development and validation of a simple and rapid capillary zone electrophoresis method for determination of nnrti nevirapine in pharmaceutical formulations

A simple and fast capillary zone electrophoresis (CZE) method has been developed and validated for quantification of a non-nucleoside reverse transcriptase inhibitor (NNRTI) nevirapine, in pharmaceuticals. The analysis was optimized using 10 mmol L-1 sodium phosphate buffer pH 2.5, +25 kV applied voltage, hydrodynamic injection 0.5 psi for 5 s and direct UV detection at 200 µm. Diazepam (50.0 µg mL-1) was used as internal standard. Under these conditions, nevirapine was analyzed in approximately less than 2.5 min. The analytical curve presented a coefficient of correlation of 0.9994. Limits of detection and quantification were 1.4 µg mL-1 and 4.3 µg mL-1, respectively. Intra- and inter-day precision expressed as relative standard deviations were 1.4% and 1.3%, respectively and the mean recovery was 100.81%. The active pharmaceutical ingredient was subjected to hydrolysis (acid, basic and neutral) and oxidative stress conditions. No interference of degradation products and tablet excipients were observed. This method showed to be rapid, simple, precise, accurate and economical for determination of nevirapine in pharmaceuticals and it is suitable for routine quality control analysis since CE offers benefits in terms of quicker method development and significantly reduced operating costs.

Development of a flow through photo-reactor to study degradation of organic compounds by Sequential Injection Analysis (SIA)

This work describes a photo-reactor to perform in line degradation of organic compounds by photo-Fenton reaction using Sequential Injection Analysis (SIA) system. A copper phthalocyanine-3,4',4²,4²¢-tetrasulfonic acid tetrasodium salt dye solution was used as a model compound for the phthalocyanine family, whose pigments have a large use in automotive coatings industry. Based on preliminary tests, 97% of color removal was obtained from a solution containing 20 µmol L-1 of this dye.

Analysis of mangrove forest succession, using sediment cores: a case study in the Cananéia -Iguape coastal system, São Paulo Brazil

Sediment cores are an essential tool for the analysis of the dynamics of mangrove succession. Coring was used to correlate changes in depositional environments and lateral sedimentary facies with discrete stages of forest succession at the Cananéia-Iguape Coastal System in southeastern Brazil. A local level successional pattern was examined based on four core series T1) a sediment bank; T2) a smooth cordgrass Spartina alterniflora bank; T3) an active mangrove progradation fringe dominated by Laguncularia racemosa, and; T4) a mature mangrove forest dominated by Avicennia schaueriana. Cores were macroscopically described in terms of color, texture, sedimentary structure and organic components. The base of all cores exhibited a similar pattern suggesting common vertical progressive changes in depositional conditions and subsequent successional colonization pattern throughout the forest. The progradation zone is an exposed bank, colonized by S. alterniflora. L. racemosa, replaces S. alterniflora as progradation takes place. As the substrate consolidates A. schaueriana replaces L. racemosa and attains the greatest structural development in the mature forest. Cores collected within the A. schaueriana dominated stand contained S. alterniflora fragments near the base, confirming that a smooth cordgrass habitat characterized the establishment and early seral stages. Cores provide a reliable approach to describe local-level successional sequences in dynamic settings subject to drivers operating on multiple temporal and spatial scales where spatial heterogeneity can lead to multiple equilibria and where similar successional end-points may be reached through convergent paths.

DEVELOPMENT OF A NOVEL SET OF MICROSATELLITE MARKERS FOR CASTOR BEAN, RICINUS COMMUNIS (EUPHORBIACEAE)

Premise of study: Microsatellite primers were developed for castor bean (Ricinus communis L.) to investigate genetic diversity and population structure, and to provide support to germplasm management. Methods and Results: Eleven microsatellite loci were isolated using an enrichment cloning protocol and used to characterize castor bean germplasm from the collection at the Instituto Agronomico de Campinas (IAC). In a survey of 76 castor bean accessions, the investigated loci displayed polymorphism ranging from two to five alleles. Conclusions: The information derived from microsatellite markers led to significant gains in conserved allelic richness and provides support to the implementation of several molecular breeding strategies for castor bean.

DEVELOPMENT OF MICROSATELLITE MARKERS FOR AULONEMIA ARISTULATA (POACEAE) AND CROSS-AMPLIFICATION IN OTHER BAMBOO SPECIES

Premise of the study: Microsatellite primers were developed for Aulonemia aristulata, an endangered species of economic interest, to further describe its genetic variability and population structure. We also tested cross-amplification in 18 other bamboo species. Methods and Results: Using an enrichment genomic library, 13 microsatellite loci were isolated and characterized in A. aristulata. Seven of these loci were polymorphic. Twelve markers were cross-amplified in at least ten of the tested bamboo species. Conclusions: These markers will be useful for studies on the genetic diversity and structure of A. aristulata, which are important for future conservation, management and breeding programs of this species.

The development of an immobilized enzyme reactor containing glyceraldehyde-3-phosphate dehydrogenase from Trypanosoma cruzi: the effect of species' specific differences on the immobilization

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in the life cycle of the Trypanosoma cruzi, and an immobilized enzyme reactor (IMER) has been developed for use in the on-line screening for GAPDH inhibitors. An IMER containing human GAPDH has been previously reported; however, these conditions produced a T. cruzi GAPDH-IMER with poor activity and stability. The factors affecting the stability of the human and T. cruzi GAPDHs in the immobilization process and the influence of pH and buffer type on the stability and activity of the IMERs have been investigated. The resulting T. cruzi GAPDH-IMER was coupled to an analytical octyl column, which was used to achieve chromatographic separation of NAD+ from NADH. The production of NADH stimulated by D-glyceraldehyde-3-phosphate was used to investigate the activity and kinetic parameters of the immobilized T. cruzi GAPDH. The Michaelis-Menten constant (K-m) values determined for D-glyceraldehyde-3-phosphate and NAD(+) were K-m = 0.5 +/- 0.05 mM and 0.648 +/- 0.08 mM, respectively, which were consistent with the values obtained using the non-immobilized enzyme.

Development of Hepatitis C Virus Genotyping by Real-Time PCR Based on the NS5B Region

Background: Hepatitis C virus (HCV) genotyping is the most significant predictor of the response to antiviral therapy. The aim of this study was to develop and evaluate a novel real-time PCR method for HCV genotyping based on the NS5B region. Methodology/Principal Findings: Two triplex reaction sets were designed, one to detect genotypes 1a, 1b and 3a; and another to detect genotypes 2a, 2b, and 2c. This approach had an overall sensitivity of 97.0%, detecting 295 of the 304 tested samples. All samples genotyped by real-time PCR had the same type that was assigned using LiPA version 1 (Line in Probe Assay). Although LiPA v. 1 was not able to subtype 68 of the 295 samples (23.0%) and rendered different subtype results from those assigned by real-time PCR for 12/295 samples (4.0%), NS5B sequencing and real-time PCR results agreed in all 146 tested cases. Analytical sensitivity of the real-time PCR assay was determined by end-point dilution of the 5000 IU/ml member of the OptiQuant HCV RNA panel. The lower limit of detection was estimated to be 125 IU/ml for genotype 3a, 250 IU/ml for genotypes 1b and 2b, and 500 IU/ml for genotype 1a. Conclusions/Significance: The total time required for performing this assay was two hours, compared to four hours required for LiPA v. 1 after PCR-amplification. Furthermore, the estimated reaction cost was nine times lower than that of available commercial methods in Brazil. Thus, we have developed an efficient, feasible, and affordable method for HCV genotype identification.

Development and mechanical testing of a short intramedullary nail for fixation of femoral rotational osteotomy in cerebral palsy patients

Background: Rotational osteotomy is frequently indicated to correct excessive femoral anteversion in cerebral palsy patients. Angled blade plate is the standard fixation device used when performed in the proximal femur, but extensile exposure is required for plate accommodation. The authors developed a short locked intramedullary nail to be applied percutaneously in the fixation of femoral rotational osteotomies in children with cerebral palsy and evaluated its mechanical properties. Methods: The study was divided into three stages. In the first part, a prototype was designed and made based on radiographic measurements of the femoral medullary canal of ten-year-old patients. In the second, synthetic femoral models based on rapid-prototyping of 3D reconstructed images of patients with cerebral palsy were obtained and were employed to adjust the nail prototype to the morphological changes observed in this disease. In the third, rotational osteotomies were simulated using synthetic femoral models stabilized by the nail and by the AO-ASIF fixed-angle blade plate. Mechanical testing was done comparing both devices in bending-compression and torsion. Results: The authors observed proper adaptation of the nail to normal and morphologically altered femoral models, and during the simulated osteotomies. Stiffness in bending-compression was significantly higher in the group fixed by the plate (388.97 +/- 57.25 N/mm) than in that fixed by the nail (268.26 +/- 38.51 N/mm) as torsional relative stiffness was significantly higher in the group fixed by the plate (1.07 +/- 0.36 Nm/degrees) than by the nail (0.35 +/- 0.13 Nm/degrees). Conclusions: Although the device presented adequate design and dimension to fit into the pediatric femur, mechanical tests indicated that the nail was less stable than the blade plate in bending-compression and torsion. This may be a beneficial property, and it can be attributed to the more flexible fixation found in intramedullary devices.

Relatedness and HLA-DRB1 typing may discriminate the magnitude of the genetic susceptibility to tuberculosis using a household contact model

Background Tuberculosis clusters in families may be due to increased household exposure, shared genetic factors, or both. Household contact studies are useful to control exposure because socioeconomic and environmental conditions are similar to all subjects, allowing the evaluation of the contribution of relatedness to disease development. Methods In this study, the familial aggregation of tuberculosis using relatedness and a specific inherited marker (HLA-DRB1) was evaluated. Fifty families, which had at least two cases of tuberculosis diagnosed within the past 5 years, were selected from a cohort of tuberculosis carried out in Recife, Brazil. The first case diagnosed was considered to be a primary case. The secondary attack rate of tuberculosis in household contacts was estimated according to the degree of relatedness. The relative risk of having tuberculosis based on the degree of relatedness household and the population attributable fraction to relatedness were also estimated. HLA-DRB1 typing and attributable etiologic/preventive fractions were calculated among sick and healthy household contacts. Results Compared to unrelated contacts, the relative risk for tuberculosis adjusted for age was 1.38 (95% CI 0.86 to 2.21). Relatedness contributed 23% to the development of tuberculosis at the population levels. The HLA-DRB1*04 allele group (OR = 2.44; p =0.0324; etiologic fraction =0.15) was overrepresented and the DRB1*15 allele group (OR=0.48; p=0.0488; protective fraction=0.19) was underrepresented among household contacts exhibiting tuberculosis. The presence of DRB1 shared alleles between primary cases and their contacts was a risk factor for tuberculosis (p=0.0281). Conclusion This household contact model together with the utilisation of two genetic variables permitted the evaluation of genetic factors contributing towards tuberculosis development.

Naturally-acquired humoral immune responses against the N- and C-termini of the Plasmodium vivax MSP1 protein in endemic regions of Brazil and Papua New Guinea using a multiplex assay

Background: Progress towards the development of a malaria vaccine against Plasmodium vivax, the most widely distributed human malaria parasite, will require a better understanding of the immune responses that confer clinical protection to patients in regions where malaria is endemic. Methods: Glutathione S-transferase (GST) and GST-fusion proteins representing the N-terminus of the merozoite surface protein 1 of P. vivax, PvMSP1-N, and the C-terminus, PvMSP1-C, were covalently coupled to BioPlex carboxylated beads. Recombinant proteins and coupled beads were used, respectively, in ELISA and Bioplex assays using immune sera of P. vivax patients from Brazil and PNG to determine IgG and subclass responses. Concordances between the two methods in the seropositivity responses were evaluated using the Kappa statistic and the Spearman's rank correlation. Results: The results using this methodology were compared with the classical microtitre enzyme-linked immnosorbent assay ( ELISA), showing that the assay was sensitive, reproducible and had good concordance with ELISA; yet, further research into different statistical analyses seems desirable before claiming conclusive results exclusively based on multiplex assays. As expected, results demonstrated that PvMSP1 was immunogenic in natural infections of patients from different endemic regions of Brazil and Papua New Guinea ( PNG), and that age correlated only with antibodies against the C-terminus part of the molecule. Furthermore, the IgG subclass profiles were different in these endemic regions having IgG3 predominantly recognizing PvMSP1 in Brazil and IgG1 predominantly recognizing PvMSP1 in PNG. Conclusions: This study validates the use of the multiplex assay to measure naturally-acquired IgG antibodies against the merozoite surface protein 1 of P. vivax.