An extract of Polygonum multiflorum protects against free radical damage induced by ultraviolet B irradiation of the skin

Over the last decades, the incidence of ultraviolet B (UVB)-related skin problems has been increasing. Damages induced by UVB radiation are related to mutations that occur as a result of direct DNA damage and/or the production of reactive oxygen species. We investigated the anti-oxidant effects of a Polygonum multiflorum thumb extract against skin damage induced by UVB irradiation. Female SKH-1 hairless mice were divided into three groups: control (N = 7), distilled water- (N = 10), and P. multiflorum extract-treated (PM, N = 10) groups. The PM (10 g) was extracted with 100 mL distilled water, cryo-dried and 9.8 g was obtained. The animals received a topical application of 500 µL distilled water or PM extract (1, 2, 4, 8, and 16%, w/v, dissolved in distilled water) for 30 min after UVB irradiation (wavelength 280-320 nm, 300 mJ/cm²; 3 min) of the dorsal kin for 14 days, and skin immunohistochemistry and Cu,Zn-superoxide dismutase (SOD1) activity were determined. SOD1 immunoreactivity, its protein levels and activities in the skin were significantly reduced by 70% in the distilled water-treated group after UVB irradiation compared to control. However, in the PM extract-treated groups, SOD1 immunoreactivity and its protein and activity levels increased in a dose-dependent manner (1-16%, w/v, PM extract) compared to the distilled water-treated group. SOD1 protein levels and activities in the groups treated with 8 and 16%, w/v, PM extract recovered to 80-90% of the control group levels after UVB. These results suggest that PM extract strongly inhibits the destruction of SOD1 by UV radiation and probably contains anti-skin photoaging agents.

The northern provinces of Sweden and Norway with part I, of Russia / published under the superintendence of the Society for the Diffusion of Useful Knowledge.

[N. 1:4400000].

Modifications of the sympathetic skin response in workers chronically exposed to lead

The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR) was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS) involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9). The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%), axonal sensorimotor polyneuropathy in 2 (3.3%), and carpal tunnel syndrome in 6 (10%). SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3%) reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.

Antimicrobial activity of the essential oil from Lippia sidoides, carvacrol and thymol against oral pathogens

Dental caries and periodontal disease are associated with oral pathogens. Several plant derivatives have been evaluated with respect to their antimicrobial effects against such pathogenic microorganisms. Lippia sidoides Cham (Verbenaceae), popularly known as "Alecrim-pimenta" is a typical shrub commonly found in the Northeast of Brazil. Many plant species belonging to the genus Lippia yield very fragrant essential oils of potential economic value which are used by the industry for the commercial production of perfumes, creams, lotions, and deodorants. Since the leaves of L. sidoides are also extensively used in popular medicine for the treatment of skin wounds and cuts, the objective of the present study was to evaluate the composition and antimicrobial activity of L. sidoides essential oil. The essential oil was obtained by hydro-distillation and analyzed by GC-MS. Twelve compounds were characterized, having as major constituents thymol (56.7%) and carvacrol (16.7%). The antimicrobial activity of the oil and the major components was tested against cariogenic bacterial species of the genus Streptococcus as well as Candida albicans using the broth dilution and disk diffusion assays. The essential oil and its major components thymol and carvacrol exhibited potent antimicrobial activity against the organisms tested with minimum inhibitory concentrations ranging from 0.625 to 10.0 mg/mL. The most sensitive microorganisms were C. albicans and Streptococcus mutans. The essential oil of L. sidoides and its major components exert promising antimicrobial effects against oral pathogens and suggest its likely usefulness to combat oral microbial growth.

Proton magnetic resonance spectroscopy of the frontal, cingulate and perirolandic cortices and its relationship to skin conductance in patients with schizophrenia

The aim of the present study was to determine whether specific subgroups of schizophrenic patients, grouped according to electrodermal characteristics, show differences in the N-acetylaspartate/creatine plus choline (NAA / (Cr + Cho)) ratios in the frontal, cingulate and perirolandic cortices. Skin conductance levels (SCL) and skin conductance responses to auditory stimulation were measured in 38 patients with schizophrenia and in the same number of matched healthy volunteers (control). All subjects were submitted to multivoxel proton magnetic resonance spectroscopic imaging. When compared to the control group, patients presented significantly lower NAA / (Cr + Cho) ratios in the right dorsolateral prefrontal cortex (schizophrenia = 0.95 ± 0.03; control = 1.12 ± 0.04) and in the right (schizophrenia = 0.88 ± 0.02; control = 0.94 ± 0.03) and left (schizophrenia = 0.84 ± 0.03; control = 0.94 ± 0.03) cingulates. These ratios did not differ between electrodermally responsive and non-responsive patients. When patients were divided into two groups: lower SCL (less than the mean SCL of the control group minus two standard deviations) and normal SCL (similar to the control group), the subgroup with a lower level of SCL showed a lower NAA / (Cr + Cho) ratio in the left cingulate (0.78 ± 0.05) than the controls (0.95 ± 0.02, P < 0.05) and the subgroup with normal SCL (0.88 ± 0.03, P < 0.05). There was a negative correlation between the NAA / (Cr + Cho) ratio in the left cingulate of patients with schizophrenia and the duration of the disease and years under medication. These data suggest the existence of a schizophrenic subgroup characterized by low SCL that could be a consequence of the lower neuronal viability observed in the left cingulate of these patients.

Anti-Leishmania titers and positive skin tests in patients cured of kala-azar

Visceral leishmaniasis (VL), also known as kala-azar, is an important public health problem. If not treated, virtually all clinically symptomatic patients die within months. The diagnosis is based on the Montenegro skin test (MST) and anti-Leishmania titers. Nevertheless, the time required for cured individuals living in a leishmaniasis-endemic area to present a positive skin test and negative anti-Leishmania serology is known. To determine the cellular and humoral immune response profile in relation to different times post-VL cure, a cross-sectional study was conducted on subjects from a kala-azar endemic area in Paço do Lumiar, MA, Brazil, on the basis of 1995-2005 notifications reported by the National Health Foundation/Regional Coordination of Maranhão. We visited cured individuals with a history of VL within the last 10 years. Seventy-four subjects (30 females) ranging in age from 1 to 44 years were included, all of them symptom free at the time of the study. A cellular immune response was observed in 73 (98.6%) subjects, whereas no significant antibody titers were detected by indirect immunofluorescence (IIF) in the sera of 69 (93.2%) cases. Ten years post-cure, 39 (52%) subjects had a positive MST and negative IIF reaction, while in one subject the skin and anti-Leishmania serology tests were negative. Two other subjects were positive in both tests 1 year after cure. These data suggest that a cellular immune response may still be present in subjects cured of VL regardless of post-cure time, and that the parasite persists in the host after clinical cure of the disease. This would explain the persistence of significant Leishmania sp antibody titers in some subjects after treatment.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Prolonged acceptance of skin grafts induced by B cells places regulatory T cells on the histopathology scene

The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

High prevalence of methicillin resistance and PVL genes amongStaphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Assessment of the diagnostic value of diffusion tensor imaging in patients with spinal cord compression: a meta-analysis

We investigated the diagnostic value of the apparent diffusion coefficient (ADC) and fractional anisotropy (FA) of magnetic resonance diffusion tensor imaging (DTI) in patients with spinal cord compression (SCC) using a meta-analysis framework. Multiple scientific literature databases were exhaustively searched to identify articles relevant to this study. Mean values and standardized mean differences (SMDs) were calculated for the ADC and FA in normal and diseased tissues. The STATA version 12.0 software was used for statistical analysis. Of the 41 articles initially retrieved through database searches, 11 case-control studies were eligible for the meta-analysis and contained a combined total of 645 human subjects (394 patients with SCC and 251 healthy controls). All 11 studies reported data on FA, and 9 contained data related to the ADC. The combined SMDs of the ADC and FA showed that the ADC was significantly higher and the FA was lower in patients with SCC than in healthy controls. Subgroup analysis based on the b value showed higher ADCs in patients with SCC than in healthy controls at b values of both ≤500 and >500 s/mm2. In summary, the main findings of this meta-analysis revealed an increased ADC and decreased FA in patients with SCC, indicating that DTI is an important diagnostic imaging tool to assess patients suspected to have SCC.

Multicomponent diffusion during Prato cheese ripening: mathematical modeling using the finite element method

The partial replacement of NaCl by KCl is a promising alternative to produce a cheese with lower sodium content since KCl does not change the final quality of the cheese product. In order to assure proper salt proportions, mathematical models are employed to control the product process and simulate the multicomponent diffusion during the reduced salt cheese ripening period. The generalized Fick's Second Law is widely accepted as the primary mass transfer model within solid foods. The Finite Element Method (FEM) was used to solve the system of differential equations formed. Therefore, a NaCl and KCl multicomponent diffusion was simulated using a 20% (w/w) static brine with 70% NaCl and 30% KCl during Prato cheese (a Brazilian semi-hard cheese) salting and ripening. The theoretical results were compared with experimental data, and indicated that the deviation was 4.43% for NaCl and 4.72% for KCl validating the proposed model for the production of good quality, reduced-sodium cheeses.