889 resultados para REPEATS
Resumo:
Plants can recognize and resist invading pathogens by signaling the induction of rapid defense responses. Often these responses are mediated by single dominant resistance genes (R genes). The products of R genes have been postulated to recognize the pathogen and trigger rapid host defense responses. Here we describe isolation of the classical resistance gene N of tobacco that mediates resistance to the well-characterized pathogen tobacco mosaic virus (TMV). The N gene was isolated by transposon tagging using the maize Activator (Ac) transposon. We confirmed isolation of the N gene by complementation of the TMV-sensitive phenotype with a genomic DNA fragment. Sequence analysis of the N gene shows that it encodes a protein with an amino-terminal domain similar to that of the cytoplasmic domains of the Drosophila Toll protein and the interleukin 1 receptor in mammals, a putative nucleotide-binding site and 14 imperfect leucine-rich repeats. The presence of these functional domains in the predicted N gene product is consistent with the hypothesis that the N resistance gene functions in a signal transduction pathway. Similarities of N to Toll and the interleukin 1 receptor suggest a similar signaling mechanism leading to rapid gene induction and TMV resistance.
Resumo:
The plant defense response to microbial pathogens had been studied primarily by using biochemical and physiological techniques. Recently, several laboratories have developed a variety of pathosystems utilizing Arabidopsis thaliana as a model host so that genetic analysis could also be used to study plant defense responses. Utilizing a pathosystem that involves the infection of Arabidopsis with pathogenic pseudomonads, we have cloned the Arabidopsis disease-resistance gene RPS2, which corresponds to the avirulence gene avrRpt2 in a gene-for-gene relationship. RPS2 encodes a 105-kDa protein containing a leucine zipper, a nucleotide binding site, and 14 imperfect leucine-rich repeats. The RPS2 protein is remarkably similar to the product of the tobacco N gene, which confers resistance to tobacco mosaic virus. We have also isolated a series of Arabidopsis mutants that synthesize decreased levels of an Arabidopsis phytoalexin called camalexin. Analysis of these mutants indicated that camalexin does not play a significant role in limiting growth of avirulent Pseudomonas syringae strains during the hypersensitive defense response but that it may play a role in limiting the growth of virulent strains. More generally, we have shown that we can utilize Arabidopsis to systematically dissect the defense response by isolation and characterization of appropriate defense-related mutants.
Resumo:
Natural genes and proteins often contain tandemly repeated sequence motifs that dramatically increase physiological specificity and activity. Given the selective value of such repeats, it is likely that several different mechanisms have been responsible for their generation. One mechanism that has been shown to generate relatively long tandem repeats (in the kilobase range) is rolling circle replication. In this communication, we demonstrate that rolling circle synthesis in a simple enzymatic system can produce tandem repeats of monomers as short as 34 bp. In addition to suggesting possible origins for natural tandem repeats, these observations provide a facile means for constructing libraries of repeated motifs for use in "in vitro evolution" experiments designed to select molecules with defined biological or chemical properties.
Resumo:
Low-copy repeats have been associated with genomic rearrangements and have been implicated in the generation of mutations in several diseases. Here we characterize a subset of low-copy repeats in the spinal muscular atrophy (SMA) region in human chromosome 5q13. We show that this repeated sequence, named c41-cad, is a highly expressed pseudogene derived from an intact neuronal cadherin gene, Br-cadherin, situated on 5p13-14. Br-cadherin is expressed specifically in the brain, whereas the c41-cad transcripts are 10-15 times more abundant and are present in all tissues examined. We speculate that the c41-cad repeats, separately or in concert with other repeats in the SMA region, are involved in the pathogenesis of SMA by promoting rearrangements and deletions.
Resumo:
We report here the identification of a pollen-specific gene from Zea mays that contains multiple Ser-(Pro)n repeats, the motif found in the cell wall-associated extensins. Sequence analysis reveals that the encoded protein has a putative globular domain at the N terminus and an extensin-like domain at the C terminus. The Pex1 (pollen extensin-like) gene is expressed exclusively in pollen, not in vegetative or female tissues, and is not induced in leaves upon wounding. We propose that the encoded protein may have a role in reproduction, either as a structural element deposited in the pollen tube wall during its rapid growth or as a sexual recognition molecule that interacts with partner molecules in the pistil.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
GabR è un fattore di trascrizione chimerico appartenente alla famiglia dei MocR/GabR, costituito da un dominio N-terminale elica-giro-elica di legame al DNA e un dominio effettore e/o di oligomerizzazione al C-terminale. I due domini sono connessi da un linker flessibile di 29 aminoacidi. Il dominio C-terminale è strutturalmente omologo agli enzimi aminotransferasici fold-type I, i quali, utilizzando il piridossal-5’-fosfato (PLP) come cofattore, sono direttamente coinvolti nel metabolismo degli aminoacidi. L’interazione contemporanea di PLP e acido γ-aminobutirrico (GABA) a GabR fa sì che questa promuova la trascrizione di due geni, gabT e gabD, implicati nel metabolismo del GABA. GabR cristallizza come un omodimero con una configurazione testa-coda. Il legame con la regione promotrice gabTD avviene attraverso il riconoscimento specifico di due sequenze dirette e ripetute (ATACCA), separate da uno spacer di 34 bp. In questo studio sono state indagate le proprietà biochimiche, strutturali e di legame al DNA della proteina GabR di Bacillus subtilis. L’analisi spettroscopica dimostra che GabR interagisce con il PLP formando l’aldimina interna, mentre in presenza di GABA si ottiene l’aldimina esterna. L’interazione fra il promotore gabTD e le forme holo e apo di GabR è stata monitorata mediante Microscopia a Forza atomica (AFM). In queste due condizioni di legame è stata stimata una Kd di circa 40 ηM. La presenza di GABA invece, determinava un incremento di circa due volte della Kd, variazioni strutturali nei complessi GabR-DNA e una riduzione del compattamento del DNA alla proteina, indipendentemente dalla sequenza del promotore in esame. Al fine di valutare il ruolo delle caratteristiche topologiche del promotore, sono state inserite cinque e dieci bp all’interno della regione spacer che separa le due sequenze ripetute dirette riconosciute da GabR. I significativi cambiamenti topologici riscontrati nel frammento aggiunto di cinque bp si riflettono anche sulla forte riduzione dell’affinità di legame verso la proteina. Al contrario, l’inserzione di 10 bp provoca solamente l’allontanamento delle sequenze ripetute dirette. L’assenza quindi di cambiamenti significativi nella topologia di questo promotore fa sì che l’affinità di legame per GabR rimanga pressoché inalterata rispetto al promotore non mutato. L’analisi del potenziale elettrostatico superficiale di GabR mostra la presenza di una fascia carica positivamente che si estende lungo un’intera faccia della proteina. Per verificare l’importanza di questa caratteristica di GabR nel meccanismo di interazione al DNA, sono stati preparati ed indagati i mutanti R129Q e K362-366Q, in cui la carica positiva superficiale risultava indebolita. L’affinità di legame dei mutanti di GabR per il DNA era inferiore rispetto alla proteina non mutata, in particolar modo nel mutante K362-366Q. Le evidenze acquisite suggeriscono che la curvatura intrinseca del promotore ed il corretto orientamento delle sequenze sulla doppia elica, più della distanza che le separa, siano critici per sostenere l’interazione con GabR. Oltre a questo, la superficie positiva di GabR è richiesta per accomodare la curvatura del DNA sul corpo della proteina. Alla luce di questo, l’interazione GabR-gabTD è un esempio di come il riconoscimento specifico di sequenze, la topologia del DNA e le caratteristiche strutturali della proteina siano contemporaneamente necessarie per sostenere un’interazione proteina-DNA stabile.
Resumo:
Proteínas PUF regulam a estabilidade e a tradução através da ligação a seqüências específicas nas regiões 3\' não traduzidas (3\' UTR) dos mensageiros. A ligação é mediada por um domínio de ligação conservado constituído por 8 repetições de aproximadamente 36 aminoácidos cada. Experimentos realizados no sistema triplo-híbrido de levedura mostraram que os homólogos PUF de Arabidopsis APUM-1, APUM-2 e APUM-3 são capazes de ligar especificamente à seqüência chamada de Elemento de Resposta a NANOS (NRE) reconhecida pelo homólogo PUF de Drosophila. A utilização de bibliotecas de expressão de RNA em ensaios no sistema triplo-híbrido permitiu a identificação de seqüências de ligação consenso para as três proteínas APUM. Análises computacionais identificaram elementos de ligação a APUM em regiões 3\' UTR de importantes transcritos relacionados ao controle do meristema do caule e à manutenção das células totipotentes. Nós mostramos que os homólogos APUM-l, APUM-2 e APUM-3 reconhecem elementos de ligação a APUM nas regiões 3\' UTR dos transcritos WUSCHEL, CLAVATA-1, ZWILLE e FASCIATA-2. Ensaios de RT-PCR e Western blot semiquantitativos mostraram que a quantidade dos transcritos WUSHEL e CLAVATA-1 é alterada em plantas antisenso induzíveis para APUM-l, APUM-2 e APUM-3. A relevância biológica dessas interações foi observada através de ensaios de coimunoprecipitação, confirmando, portanto, o primeiro caso de regulação traducional descrito para os mensageiros WUSCHEL e CLAVATA-1. Análises computacionais adicionais para a identificação de outros homólogos PUF em Arabidopsis encontraram vinte e cinco proteínas possuindo repetições PUF. Entre elas, os homólogos APUM-4, APUM-S e APUM-6 apresentam alta similaridade com as proteínas APUM-l, APUM-2 e APUM-3, sendo capazes de ligar especificamente à seqüência NRE e aos elementos de ligação a APUM presentes nas regiões 3\' UTR dos transcritos WUSCHEL, CLAVATA-1, ZWILLE e FASCIATA-ts resultados indicam que vários homólogos PUF podem agir como reguladores traducionais em Arabidopsis através de um mecanismo molecular conservado entre as espécies, podendo abrir uma nova área de investigação da regulação de mRNA em plantas.
Resumo:
Tau filaments are the pathological hallmark of >20 neurodegenerative diseases including Alzheimer's disease, Pick's disease, and progressive supranuclear palsy. In the adult human brain, six isoforms of tau are expressed that differ by presence or absence of the second of the four semiconserved repeats. As a consequence, half of the tau isoforms have three repeats (3R tau), whereas the other half has four repeats (4R tau). Site-directed spin labeling of recombinant tau in conjunction with electron paramagnetic resonance spectroscopy was used to obtain structural insights into tau filaments. The studies showed that the filaments of 4R tau and 3R tau share a highly ordered core structure in the third repeat with parallel, in-register arrangement of beta-strands. This structure in 3R and 4R is conserved regardless of whether full-length isoforms (htau40 and htau23) or truncated constructs (K18 and K19) are used. When mixed, 3R tau and 4R tau coassembled into heterogeneous filaments. Hence, these findings indicate that there are at least three compositionally distinct types of filaments: homogeneous 3R tau, homogeneous 4R tau, and heterogeneous 3R/4R tau. In vitro experiments show that the seeded filament growth, a prerequisite for tau spreading in tissue culture and brain, is crucially dependent on the isoform composition of individual seeds. Seeds of 3R tau and 3R/4R tau recruit both types of isoforms whereas seeds of 4R tau can recruit 4R tau, but not 3R tau, establishing an asymmetric barrier. Conformational templating of 4R tau onto 3R tau seeds eliminates this barrier, giving rise to a new type of tau filament. Conformational studies at the molecular level of tau filaments were done using Double electron-electron resonance spectroscopy, which allows the determination of distances between pairs of spin labels. These studies revealed structural differences between filaments of 3R tau and 4R tau. Furthermore, they indicated that 4R tau assumed the conformation of 3R tau when templated on 3R tau seeds. Our measurements have also provided insights into the heterogeneity of tau filament structure. Conformational differences due to variation in filament composition and seeding properties of tau filaments have shown that they are structurally polymorphic in nature. This structural polymorphism of tau filaments has widespread implications in understanding and treatment of neurodegenerative diseases.
Resumo:
Substances containing unpaired electrons have been studied by electron paramagnetic resonance (EPR) for nearly 70 years. With continual development and enhancement of EPR techniques, questions have arisen regarding optimum method selection for a given sample based on its properties. In this work, radiation defects, natural lattice defects, solid organic radicals, radicals in solution, and spin-labeled proteins were analyzed using CW, pulse, and rapid scan EPR to compare methods. Studies of solid BDPA, EOe in quartz, Ns0 in diamond, and a-Si:H, showed that rapid scan could overcome many obstacles presented by other techniques, cementing rapid scan as an effective alternative to CW and pulse methods. Relaxation times of six nitroxide radicals were characterized from 0.25-34 GHz, guiding synthesis of improved nitroxides for in vivo imaging experiments. Processes contributing to T1 of DPPH in polystyrene were found through variable temperature measurements at X- and Q-band, resolving previously-reported discrepancies in relaxation properties and providing new insight into this commonly-used standard. In the history of EPR, the study of proteins is relatively new. Double electron-electron resonance (DEER) has emerged as a powerful technique for the study of amyloid fibrils, a class of protein aggregates implicated in a number of neurodegenerative disorders. Microtubule-associated protein tau forms fibrils linked to Alzheimerfs disease through seeded conversion of monomer. Self-assembly is mediated by the microtubule binding repeats in tau, and there are either three or four repeats present depending on the isoform. DEER was used to show that filaments of 3R and 4R tau are conformationally distinct and that 4R fibrils adopt a heterogeneous mixture of conformations. Populations of 4R fibril conformations, which were independently validated using a model system, can be modulated by introduction of mutations to the primary sequence or by varying fibril growth conditions. These findings provided unprecedented insights into the seed selection of tau monomers and established conformational compatibility as an important driving force in tau fibril propagation. Lastly, DEER acquisition was improved through addition of paramagnetic metal to spin-labeled protein, decreasing collection time, and through use of a novel spin label with increased T2, thereby lengthening the available acquisition window.
Resumo:
A batata-da-serra, Ipomoea serrana Sim.-Bianch. & L.V. Vasconcelos, é uma liana endêmica da Chapada Diamantina, Bahia, cuja raiz tuberosa e consumida por populações humanas ha muitos anos. Apesar da espécie, classificada como vulnerável pela IUCN (União Internacional para a Conservação da Natureza), estar submetida à pressão antrópica devido à exploração de raízes tuberosas, para uso na alimentação, são raros os estudos com a espécie, razão pela qual e de grande importância conhecer a diversidade e estrutura genética da espécie. Estudos sobre diversidade e estrutura genética a partir de marcadores moleculares são importantes por fornecerem dados sobre impactos da exploração antrópica sobre as populações, podendo oferecer subsídio para planos de manejo e conservação de espécie. Cinco populações da Chapada Diamantina, constituindo um total de 142 indivíduos, foram investigados com quatro iniciadores Inter Simple Sequence Repeats (ISSR), resultando em 34 bandas, das quais 25 foram polimórficas. A analise dos parâmetros genéticos mostrou que as populações apresentam variabilidade moderada, com 73,8% de bandas polimórficas, 0,264 de índice de diversidade de Nei e 0,389 de índice de Shannon (valores médios). A maior parte da variação ocorreu dentro das populações (77%), estimado pela analise de variância molecular (AMOVA), enquanto que a variação entre populações foi de 23%, o que corroborou os resultados de estruturação obtidos pelo programa Structure, analise de coordenadas principais (PCoA) e agrupamento estimado pelo método Neighbor-Joining, a partir do coeficiente de dissimilaridade de Jaccard. A analise Bayesiana separou os indivíduos em quatro grupos, sendo que as populações Andaraí e Capão foram alocadas em grupos distintos, enquanto as outras três populações compartilharam indivíduos distribuídos em outros dois grupos. Este estudo, por seu caráter pioneiro com relação aos marcadores moleculares, constituiu o primeiro passo para o conhecimento da diversidade genética da espécie. Estudos futuros poderão ampliar o conhecimento sobre a espécie podendo oferecer subsidio para a elaboração de um plano de manejo para esta espécie que tem sido explorada na região.
Resumo:
Summary. For more than two decades, the development of renewable energy sources (RES) has been an important aim of EU energy policy. It accelerated with the adoption of a 1997 White Paper and the setting a decade later of a 20% renewable energy target, to be reached by 2020. The EU counts on renewable energy for multiple purposes: to diversify its energy supply; to increase its security of supply; and to create new industries, jobs, economic growth and export opportunities, while at the same time reducing greenhouse gas (GHG) emissions. Many expectations rest on its development. Fossil fuels have been critical to the development of industrial nations, including EU Member States, which are now deeply reliant upon coal, oil and gas for nearly every aspect of their existence. Faced with some hard truths, however, the Member States have begun to shelve fossil fuel. These hard truths are as follows: firstly, fossil fuels are a finite resource, sometimes difficult to extract. This means that, at some point, fossil fuels are going to be more difficult to access in Europe or too expensive to use.1 The problem is that you cannot just stop using fossil fuels when they become too expensive; the existing infrastructure is profoundly reliant on fossil fuels. It is thus almost normal that a fierce resistance to change exists. Secondly, fossil fuels contribute to climate change. They emit GHG, which contribute greatly to climate change. As a consequence, their use needs to be drastically reduced. Thirdly, Member States are currently suffering a decline in their own fossil fuel production. This increases their dependence on increasingly costly fossil fuel imports from increasingly unstable countries. This problem is compounded by global developments: the growing share of emerging economies in global energy demand (in particular China and India but also the Middle East) and the development of unconventional oil and gas production in the United States. All these elements endanger the competitiveness of Member States’ economies and their security of supply. Therefore, new indigenous sources of energy and a diversification of energy suppliers and routes to convey energy need to be found. To solve all these challenges, in 2008 the EU put in place a strategy based on three objectives: sustainability (reduction of GHG), competitiveness and security of supply. The adoption of a renewable energy policy was considered essential for reaching these three strategic objectives. The adoption of the 20% renewable energy target has undeniably had a positive effect in the EU on the growth in renewables, with the result that renewable energy sources are steadily increasing their presence in the EU energy mix. They are now, it can be said, an integral part of the EU energy system. However, the necessity of reaching this 20% renewable energy target in 2020, combined with other circumstances, has also engendered in many Member States a certain number of difficulties, creating uncertainties for investors and postponing benefits for consumers. The electricity sector is the clearest example of this downside. Subsidies have become extremely abundant and vary from one Member State to another, compromising both fair competition and single market. Networks encountered many difficulties to develop and adapt. With technological progress these subsidies have also become quite excessive. The growing impact of renewable electricity fluctuations has made some traditional power plants unprofitable and created disincentives for new investments. The EU does clearly need to reassess its strategy. If it repeats the 2008 measures it will risk to provoke increased instability and costs.
Resumo:
Ukraine is struggling with both external aggression and the dramatically poor shape of its economy. The pace of political and institutional change has so far been too slow to prevent the deepening of the fiscal and balance-of-payments crises, while business confidence continues to be undermined. • Unfortunately, the 2015 International Monetary Fund Extended Fund Facility programme repeats many weaknesses of the 2014 IMF Stand-by Arrangement: slow pace of fiscal adjustment especially in the two key areas of energy prices and pension entitlements, lack of a comprehensive structural and institutional reform vision, and insufficient external financing to close the expected balance-of-payments gap and allow Ukraine to return to debt sustainability in the long term. • The reform process in Ukraine must be accelerated and better managed. A frontloaded fiscal adjustment is necessary to stabilise public finances and the balance-of-payments, and to bring inflation down. The international community, especially the European Union, should offer sufficient financial aid backed by strong conditionality, technical assistance and support to Ukraine’s independence and territorial integrity.
Resumo:
The involvement of A to I RNA editing in antiviral responses was first indicated by the observation of genomic hyper-mutation for several RNA viruses in the course of persistent infections. However, in only a few cases an antiviral role was ever demonstrated and surprisingly, it turns out that ADARs - the RNA editing enzymes - may have a prominent pro-viral role through the modulation/down-regulation of the interferon response. A key role in this regulatory function of RNA editing is played by ADAR1, an interferon inducible RNA editing enzyme. A distinguishing feature of ADAR1, when compared with other ADARs, is the presence of a Z-DNA binding domain, Zalpha. Since the initial discovery of the specific and high affinity binding of Zalpha to CpG repeats in a left-handed helical conformation, other proteins, all related to the interferon response pathway, were shown to have similar domains throughout the vertebrate lineage. What is the biological function of this domain family remains unclear but a significant body of work provides pieces of a puzzle that points to an important role of Zalpha domains in the recognition of foreign nucleic acids in the cytoplasm by the innate immune system. Here we will provide an overview of our knowledge on ADAR1 function in interferon response with emphasis on Zalpha domains.
Resumo:
We performed a quantitative comparison of brittle thrust wedge experiments to evaluate the variability among analogue models and to appraise the reproducibility and limits of model interpretation. Fifteen analogue modeling laboratories participated in this benchmark initiative. Each laboratory received a shipment of the same type of quartz and corundum sand and all laboratories adhered to a stringent model building protocol and used the same type of foil to cover base and sidewalls of the sandbox. Sieve structure, sifting height, filling rate, and details on off-scraping of excess sand followed prescribed procedures. Our analogue benchmark shows that even for simple plane-strain experiments with prescribed stringent model construction techniques, quantitative model results show variability, most notably for surface slope, thrust spacing and number of forward and backthrusts. One of the sources of the variability in model results is related to slight variations in how sand is deposited in the sandbox. Small changes in sifting height, sifting rate, and scraping will result in slightly heterogeneous material bulk densities, which will affect the mechanical properties of the sand, and will result in lateral and vertical differences in peak and boundary friction angles, as well as cohesion values once the model is constructed. Initial variations in basal friction are inferred to play the most important role in causing model variability. Our comparison shows that the human factor plays a decisive role, and even when one modeler repeats the same experiment, quantitative model results still show variability. Our observations highlight the limits of up-scaling quantitative analogue model results to nature or for making comparisons with numerical models. The frictional behavior of sand is highly sensitive to small variations in material state or experimental set-up, and hence, it will remain difficult to scale quantitative results such as number of thrusts, thrust spacing, and pop-up width from model to nature.